ID: 953223970

View in Genome Browser
Species Human (GRCh38)
Location 3:40999485-40999507
Sequence ATCCAGCCAGCTCTCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953223970_953223972 -6 Left 953223970 3:40999485-40999507 CCCACAGGGAGAGCTGGCTGGAT No data
Right 953223972 3:40999502-40999524 CTGGATCCTGCACCGCTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953223970 Original CRISPR ATCCAGCCAGCTCTCCCTGT GGG (reversed) Intergenic
No off target data available for this crispr