ID: 953225646

View in Genome Browser
Species Human (GRCh38)
Location 3:41017011-41017033
Sequence TCTCATAGCAGATGTCAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953225646_953225656 30 Left 953225646 3:41017011-41017033 CCCTTCTGACATCTGCTATGAGA No data
Right 953225656 3:41017064-41017086 CAGCATTCAAGGTGCTATATTGG No data
953225646_953225655 19 Left 953225646 3:41017011-41017033 CCCTTCTGACATCTGCTATGAGA No data
Right 953225655 3:41017053-41017075 TCTAATGAATGCAGCATTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953225646 Original CRISPR TCTCATAGCAGATGTCAGAA GGG (reversed) Intergenic
No off target data available for this crispr