ID: 953225647

View in Genome Browser
Species Human (GRCh38)
Location 3:41017012-41017034
Sequence CTCTCATAGCAGATGTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953225647_953225655 18 Left 953225647 3:41017012-41017034 CCTTCTGACATCTGCTATGAGAG No data
Right 953225655 3:41017053-41017075 TCTAATGAATGCAGCATTCAAGG No data
953225647_953225656 29 Left 953225647 3:41017012-41017034 CCTTCTGACATCTGCTATGAGAG No data
Right 953225656 3:41017064-41017086 CAGCATTCAAGGTGCTATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953225647 Original CRISPR CTCTCATAGCAGATGTCAGA AGG (reversed) Intergenic
No off target data available for this crispr