ID: 953225651

View in Genome Browser
Species Human (GRCh38)
Location 3:41017038-41017060
Sequence TCATTAGAGGGAAGGAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953225651_953225656 3 Left 953225651 3:41017038-41017060 CCAGGGTTCCTTCCCTCTAATGA No data
Right 953225656 3:41017064-41017086 CAGCATTCAAGGTGCTATATTGG No data
953225651_953225657 12 Left 953225651 3:41017038-41017060 CCAGGGTTCCTTCCCTCTAATGA No data
Right 953225657 3:41017073-41017095 AGGTGCTATATTGGAAGCAGAGG No data
953225651_953225658 16 Left 953225651 3:41017038-41017060 CCAGGGTTCCTTCCCTCTAATGA No data
Right 953225658 3:41017077-41017099 GCTATATTGGAAGCAGAGGCTGG No data
953225651_953225655 -8 Left 953225651 3:41017038-41017060 CCAGGGTTCCTTCCCTCTAATGA No data
Right 953225655 3:41017053-41017075 TCTAATGAATGCAGCATTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953225651 Original CRISPR TCATTAGAGGGAAGGAACCC TGG (reversed) Intergenic
No off target data available for this crispr