ID: 953225652

View in Genome Browser
Species Human (GRCh38)
Location 3:41017046-41017068
Sequence TGCTGCATTCATTAGAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953225652_953225658 8 Left 953225652 3:41017046-41017068 CCTTCCCTCTAATGAATGCAGCA No data
Right 953225658 3:41017077-41017099 GCTATATTGGAAGCAGAGGCTGG No data
953225652_953225656 -5 Left 953225652 3:41017046-41017068 CCTTCCCTCTAATGAATGCAGCA No data
Right 953225656 3:41017064-41017086 CAGCATTCAAGGTGCTATATTGG No data
953225652_953225657 4 Left 953225652 3:41017046-41017068 CCTTCCCTCTAATGAATGCAGCA No data
Right 953225657 3:41017073-41017095 AGGTGCTATATTGGAAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953225652 Original CRISPR TGCTGCATTCATTAGAGGGA AGG (reversed) Intergenic
No off target data available for this crispr