ID: 953225653

View in Genome Browser
Species Human (GRCh38)
Location 3:41017050-41017072
Sequence TGAATGCTGCATTCATTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953225653_953225656 -9 Left 953225653 3:41017050-41017072 CCCTCTAATGAATGCAGCATTCA No data
Right 953225656 3:41017064-41017086 CAGCATTCAAGGTGCTATATTGG No data
953225653_953225657 0 Left 953225653 3:41017050-41017072 CCCTCTAATGAATGCAGCATTCA No data
Right 953225657 3:41017073-41017095 AGGTGCTATATTGGAAGCAGAGG No data
953225653_953225658 4 Left 953225653 3:41017050-41017072 CCCTCTAATGAATGCAGCATTCA No data
Right 953225658 3:41017077-41017099 GCTATATTGGAAGCAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953225653 Original CRISPR TGAATGCTGCATTCATTAGA GGG (reversed) Intergenic
No off target data available for this crispr