ID: 953225654

View in Genome Browser
Species Human (GRCh38)
Location 3:41017051-41017073
Sequence TTGAATGCTGCATTCATTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953225654_953225661 30 Left 953225654 3:41017051-41017073 CCTCTAATGAATGCAGCATTCAA No data
Right 953225661 3:41017104-41017126 TCACCAGACACCAAACCTGCTGG 0: 33
1: 277
2: 676
3: 1257
4: 1830
953225654_953225657 -1 Left 953225654 3:41017051-41017073 CCTCTAATGAATGCAGCATTCAA No data
Right 953225657 3:41017073-41017095 AGGTGCTATATTGGAAGCAGAGG No data
953225654_953225658 3 Left 953225654 3:41017051-41017073 CCTCTAATGAATGCAGCATTCAA No data
Right 953225658 3:41017077-41017099 GCTATATTGGAAGCAGAGGCTGG No data
953225654_953225656 -10 Left 953225654 3:41017051-41017073 CCTCTAATGAATGCAGCATTCAA No data
Right 953225656 3:41017064-41017086 CAGCATTCAAGGTGCTATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953225654 Original CRISPR TTGAATGCTGCATTCATTAG AGG (reversed) Intergenic
No off target data available for this crispr