ID: 953225656

View in Genome Browser
Species Human (GRCh38)
Location 3:41017064-41017086
Sequence CAGCATTCAAGGTGCTATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953225654_953225656 -10 Left 953225654 3:41017051-41017073 CCTCTAATGAATGCAGCATTCAA No data
Right 953225656 3:41017064-41017086 CAGCATTCAAGGTGCTATATTGG No data
953225647_953225656 29 Left 953225647 3:41017012-41017034 CCTTCTGACATCTGCTATGAGAG No data
Right 953225656 3:41017064-41017086 CAGCATTCAAGGTGCTATATTGG No data
953225653_953225656 -9 Left 953225653 3:41017050-41017072 CCCTCTAATGAATGCAGCATTCA No data
Right 953225656 3:41017064-41017086 CAGCATTCAAGGTGCTATATTGG No data
953225651_953225656 3 Left 953225651 3:41017038-41017060 CCAGGGTTCCTTCCCTCTAATGA No data
Right 953225656 3:41017064-41017086 CAGCATTCAAGGTGCTATATTGG No data
953225652_953225656 -5 Left 953225652 3:41017046-41017068 CCTTCCCTCTAATGAATGCAGCA No data
Right 953225656 3:41017064-41017086 CAGCATTCAAGGTGCTATATTGG No data
953225646_953225656 30 Left 953225646 3:41017011-41017033 CCCTTCTGACATCTGCTATGAGA No data
Right 953225656 3:41017064-41017086 CAGCATTCAAGGTGCTATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953225656 Original CRISPR CAGCATTCAAGGTGCTATAT TGG Intergenic
No off target data available for this crispr