ID: 953225658

View in Genome Browser
Species Human (GRCh38)
Location 3:41017077-41017099
Sequence GCTATATTGGAAGCAGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953225654_953225658 3 Left 953225654 3:41017051-41017073 CCTCTAATGAATGCAGCATTCAA No data
Right 953225658 3:41017077-41017099 GCTATATTGGAAGCAGAGGCTGG No data
953225652_953225658 8 Left 953225652 3:41017046-41017068 CCTTCCCTCTAATGAATGCAGCA No data
Right 953225658 3:41017077-41017099 GCTATATTGGAAGCAGAGGCTGG No data
953225653_953225658 4 Left 953225653 3:41017050-41017072 CCCTCTAATGAATGCAGCATTCA No data
Right 953225658 3:41017077-41017099 GCTATATTGGAAGCAGAGGCTGG No data
953225651_953225658 16 Left 953225651 3:41017038-41017060 CCAGGGTTCCTTCCCTCTAATGA No data
Right 953225658 3:41017077-41017099 GCTATATTGGAAGCAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953225658 Original CRISPR GCTATATTGGAAGCAGAGGC TGG Intergenic
No off target data available for this crispr