ID: 953225661

View in Genome Browser
Species Human (GRCh38)
Location 3:41017104-41017126
Sequence TCACCAGACACCAAACCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4073
Summary {0: 33, 1: 277, 2: 676, 3: 1257, 4: 1830}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953225654_953225661 30 Left 953225654 3:41017051-41017073 CCTCTAATGAATGCAGCATTCAA No data
Right 953225661 3:41017104-41017126 TCACCAGACACCAAACCTGCTGG 0: 33
1: 277
2: 676
3: 1257
4: 1830

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953225661 Original CRISPR TCACCAGACACCAAACCTGC TGG Intergenic
Too many off-targets to display for this crispr