ID: 953236418 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:41111383-41111405 |
| Sequence | CTGTAGGACCAGGTAGAGGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 953236410_953236418 | 23 | Left | 953236410 | 3:41111337-41111359 | CCTGCAGTCAGGACACACTCTGA | No data | ||
| Right | 953236418 | 3:41111383-41111405 | CTGTAGGACCAGGTAGAGGCTGG | No data | ||||
| 953236409_953236418 | 29 | Left | 953236409 | 3:41111331-41111353 | CCATTGCCTGCAGTCAGGACACA | No data | ||
| Right | 953236418 | 3:41111383-41111405 | CTGTAGGACCAGGTAGAGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 953236418 | Original CRISPR | CTGTAGGACCAGGTAGAGGC TGG | Intergenic | ||
| No off target data available for this crispr | |||||