ID: 953236418

View in Genome Browser
Species Human (GRCh38)
Location 3:41111383-41111405
Sequence CTGTAGGACCAGGTAGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953236410_953236418 23 Left 953236410 3:41111337-41111359 CCTGCAGTCAGGACACACTCTGA No data
Right 953236418 3:41111383-41111405 CTGTAGGACCAGGTAGAGGCTGG No data
953236409_953236418 29 Left 953236409 3:41111331-41111353 CCATTGCCTGCAGTCAGGACACA No data
Right 953236418 3:41111383-41111405 CTGTAGGACCAGGTAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953236418 Original CRISPR CTGTAGGACCAGGTAGAGGC TGG Intergenic
No off target data available for this crispr