ID: 953236820

View in Genome Browser
Species Human (GRCh38)
Location 3:41114155-41114177
Sequence TGGCATAGGGAGAAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953236811_953236820 5 Left 953236811 3:41114127-41114149 CCCTGGGTCACATAGAACTGGAA No data
Right 953236820 3:41114155-41114177 TGGCATAGGGAGAAGGAGGCTGG No data
953236812_953236820 4 Left 953236812 3:41114128-41114150 CCTGGGTCACATAGAACTGGAAG No data
Right 953236820 3:41114155-41114177 TGGCATAGGGAGAAGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953236820 Original CRISPR TGGCATAGGGAGAAGGAGGC TGG Intergenic
No off target data available for this crispr