ID: 953239995

View in Genome Browser
Species Human (GRCh38)
Location 3:41140451-41140473
Sequence GGGTTAATTTCCGGCCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953239995_953240002 9 Left 953239995 3:41140451-41140473 CCTGCTTGGCCGGAAATTAACCC No data
Right 953240002 3:41140483-41140505 TGGATTATGGGACTATCCAGAGG No data
953239995_953239998 -4 Left 953239995 3:41140451-41140473 CCTGCTTGGCCGGAAATTAACCC No data
Right 953239998 3:41140470-41140492 ACCCTTTAGTTGCTGGATTATGG No data
953239995_953240003 16 Left 953239995 3:41140451-41140473 CCTGCTTGGCCGGAAATTAACCC No data
Right 953240003 3:41140490-41140512 TGGGACTATCCAGAGGTCCCCGG No data
953239995_953240005 22 Left 953239995 3:41140451-41140473 CCTGCTTGGCCGGAAATTAACCC No data
Right 953240005 3:41140496-41140518 TATCCAGAGGTCCCCGGGAGAGG No data
953239995_953240008 29 Left 953239995 3:41140451-41140473 CCTGCTTGGCCGGAAATTAACCC No data
Right 953240008 3:41140503-41140525 AGGTCCCCGGGAGAGGCTGAGGG No data
953239995_953240004 17 Left 953239995 3:41140451-41140473 CCTGCTTGGCCGGAAATTAACCC No data
Right 953240004 3:41140491-41140513 GGGACTATCCAGAGGTCCCCGGG No data
953239995_953240007 28 Left 953239995 3:41140451-41140473 CCTGCTTGGCCGGAAATTAACCC No data
Right 953240007 3:41140502-41140524 GAGGTCCCCGGGAGAGGCTGAGG No data
953239995_953240000 -3 Left 953239995 3:41140451-41140473 CCTGCTTGGCCGGAAATTAACCC No data
Right 953240000 3:41140471-41140493 CCCTTTAGTTGCTGGATTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953239995 Original CRISPR GGGTTAATTTCCGGCCAAGC AGG (reversed) Intergenic
No off target data available for this crispr