ID: 953239999

View in Genome Browser
Species Human (GRCh38)
Location 3:41140471-41140493
Sequence CCCATAATCCAGCAACTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953239999_953240004 -3 Left 953239999 3:41140471-41140493 CCCTTTAGTTGCTGGATTATGGG No data
Right 953240004 3:41140491-41140513 GGGACTATCCAGAGGTCCCCGGG No data
953239999_953240014 19 Left 953239999 3:41140471-41140493 CCCTTTAGTTGCTGGATTATGGG No data
Right 953240014 3:41140513-41140535 GAGAGGCTGAGGGCTGGCATGGG No data
953239999_953240007 8 Left 953239999 3:41140471-41140493 CCCTTTAGTTGCTGGATTATGGG No data
Right 953240007 3:41140502-41140524 GAGGTCCCCGGGAGAGGCTGAGG No data
953239999_953240010 13 Left 953239999 3:41140471-41140493 CCCTTTAGTTGCTGGATTATGGG No data
Right 953240010 3:41140507-41140529 CCCCGGGAGAGGCTGAGGGCTGG No data
953239999_953240008 9 Left 953239999 3:41140471-41140493 CCCTTTAGTTGCTGGATTATGGG No data
Right 953240008 3:41140503-41140525 AGGTCCCCGGGAGAGGCTGAGGG No data
953239999_953240005 2 Left 953239999 3:41140471-41140493 CCCTTTAGTTGCTGGATTATGGG No data
Right 953240005 3:41140496-41140518 TATCCAGAGGTCCCCGGGAGAGG No data
953239999_953240003 -4 Left 953239999 3:41140471-41140493 CCCTTTAGTTGCTGGATTATGGG No data
Right 953240003 3:41140490-41140512 TGGGACTATCCAGAGGTCCCCGG No data
953239999_953240013 18 Left 953239999 3:41140471-41140493 CCCTTTAGTTGCTGGATTATGGG No data
Right 953240013 3:41140512-41140534 GGAGAGGCTGAGGGCTGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953239999 Original CRISPR CCCATAATCCAGCAACTAAA GGG (reversed) Intergenic
No off target data available for this crispr