ID: 953240000

View in Genome Browser
Species Human (GRCh38)
Location 3:41140471-41140493
Sequence CCCTTTAGTTGCTGGATTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953239992_953240000 24 Left 953239992 3:41140424-41140446 CCAGTCAGACAGACTTGGAGCTA No data
Right 953240000 3:41140471-41140493 CCCTTTAGTTGCTGGATTATGGG No data
953239991_953240000 28 Left 953239991 3:41140420-41140442 CCAGCCAGTCAGACAGACTTGGA No data
Right 953240000 3:41140471-41140493 CCCTTTAGTTGCTGGATTATGGG No data
953239995_953240000 -3 Left 953239995 3:41140451-41140473 CCTGCTTGGCCGGAAATTAACCC No data
Right 953240000 3:41140471-41140493 CCCTTTAGTTGCTGGATTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953240000 Original CRISPR CCCTTTAGTTGCTGGATTAT GGG Intergenic
No off target data available for this crispr