ID: 953240002

View in Genome Browser
Species Human (GRCh38)
Location 3:41140483-41140505
Sequence TGGATTATGGGACTATCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953239995_953240002 9 Left 953239995 3:41140451-41140473 CCTGCTTGGCCGGAAATTAACCC No data
Right 953240002 3:41140483-41140505 TGGATTATGGGACTATCCAGAGG No data
953239996_953240002 0 Left 953239996 3:41140460-41140482 CCGGAAATTAACCCTTTAGTTGC No data
Right 953240002 3:41140483-41140505 TGGATTATGGGACTATCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953240002 Original CRISPR TGGATTATGGGACTATCCAG AGG Intergenic
No off target data available for this crispr