ID: 953240008

View in Genome Browser
Species Human (GRCh38)
Location 3:41140503-41140525
Sequence AGGTCCCCGGGAGAGGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953239996_953240008 20 Left 953239996 3:41140460-41140482 CCGGAAATTAACCCTTTAGTTGC No data
Right 953240008 3:41140503-41140525 AGGTCCCCGGGAGAGGCTGAGGG No data
953240001_953240008 8 Left 953240001 3:41140472-41140494 CCTTTAGTTGCTGGATTATGGGA No data
Right 953240008 3:41140503-41140525 AGGTCCCCGGGAGAGGCTGAGGG No data
953239999_953240008 9 Left 953239999 3:41140471-41140493 CCCTTTAGTTGCTGGATTATGGG No data
Right 953240008 3:41140503-41140525 AGGTCCCCGGGAGAGGCTGAGGG No data
953239995_953240008 29 Left 953239995 3:41140451-41140473 CCTGCTTGGCCGGAAATTAACCC No data
Right 953240008 3:41140503-41140525 AGGTCCCCGGGAGAGGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953240008 Original CRISPR AGGTCCCCGGGAGAGGCTGA GGG Intergenic
No off target data available for this crispr