ID: 953240010

View in Genome Browser
Species Human (GRCh38)
Location 3:41140507-41140529
Sequence CCCCGGGAGAGGCTGAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953240001_953240010 12 Left 953240001 3:41140472-41140494 CCTTTAGTTGCTGGATTATGGGA No data
Right 953240010 3:41140507-41140529 CCCCGGGAGAGGCTGAGGGCTGG No data
953239999_953240010 13 Left 953239999 3:41140471-41140493 CCCTTTAGTTGCTGGATTATGGG No data
Right 953240010 3:41140507-41140529 CCCCGGGAGAGGCTGAGGGCTGG No data
953239996_953240010 24 Left 953239996 3:41140460-41140482 CCGGAAATTAACCCTTTAGTTGC No data
Right 953240010 3:41140507-41140529 CCCCGGGAGAGGCTGAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953240010 Original CRISPR CCCCGGGAGAGGCTGAGGGC TGG Intergenic
No off target data available for this crispr