ID: 953240013

View in Genome Browser
Species Human (GRCh38)
Location 3:41140512-41140534
Sequence GGAGAGGCTGAGGGCTGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953239999_953240013 18 Left 953239999 3:41140471-41140493 CCCTTTAGTTGCTGGATTATGGG No data
Right 953240013 3:41140512-41140534 GGAGAGGCTGAGGGCTGGCATGG No data
953239996_953240013 29 Left 953239996 3:41140460-41140482 CCGGAAATTAACCCTTTAGTTGC No data
Right 953240013 3:41140512-41140534 GGAGAGGCTGAGGGCTGGCATGG No data
953240006_953240013 -10 Left 953240006 3:41140499-41140521 CCAGAGGTCCCCGGGAGAGGCTG No data
Right 953240013 3:41140512-41140534 GGAGAGGCTGAGGGCTGGCATGG No data
953240001_953240013 17 Left 953240001 3:41140472-41140494 CCTTTAGTTGCTGGATTATGGGA No data
Right 953240013 3:41140512-41140534 GGAGAGGCTGAGGGCTGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953240013 Original CRISPR GGAGAGGCTGAGGGCTGGCA TGG Intergenic
No off target data available for this crispr