ID: 953241814

View in Genome Browser
Species Human (GRCh38)
Location 3:41156087-41156109
Sequence CAGTGCCCAGACCAGCTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953241814_953241819 18 Left 953241814 3:41156087-41156109 CCCGGCAGCTGGTCTGGGCACTG No data
Right 953241819 3:41156128-41156150 CCATCCACATTCCACAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953241814 Original CRISPR CAGTGCCCAGACCAGCTGCC GGG (reversed) Intergenic
No off target data available for this crispr