ID: 953241819

View in Genome Browser
Species Human (GRCh38)
Location 3:41156128-41156150
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953241815_953241819 17 Left 953241815 3:41156088-41156110 CCGGCAGCTGGTCTGGGCACTGT No data
Right 953241819 3:41156128-41156150 CCATCCACATTCCACAAAGCAGG No data
953241814_953241819 18 Left 953241814 3:41156087-41156109 CCCGGCAGCTGGTCTGGGCACTG No data
Right 953241819 3:41156128-41156150 CCATCCACATTCCACAAAGCAGG No data
953241812_953241819 23 Left 953241812 3:41156082-41156104 CCACTCCCGGCAGCTGGTCTGGG No data
Right 953241819 3:41156128-41156150 CCATCCACATTCCACAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type