ID: 953242476

View in Genome Browser
Species Human (GRCh38)
Location 3:41161862-41161884
Sequence CTCAATTCTGGGATGAGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953242469_953242476 -3 Left 953242469 3:41161842-41161864 CCACACAAGTCCATTCTGACCTC No data
Right 953242476 3:41161862-41161884 CTCAATTCTGGGATGAGGTAGGG No data
953242467_953242476 5 Left 953242467 3:41161834-41161856 CCAAAATCCCACACAAGTCCATT No data
Right 953242476 3:41161862-41161884 CTCAATTCTGGGATGAGGTAGGG No data
953242468_953242476 -2 Left 953242468 3:41161841-41161863 CCCACACAAGTCCATTCTGACCT No data
Right 953242476 3:41161862-41161884 CTCAATTCTGGGATGAGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953242476 Original CRISPR CTCAATTCTGGGATGAGGTA GGG Intergenic
No off target data available for this crispr