ID: 953243273

View in Genome Browser
Species Human (GRCh38)
Location 3:41168186-41168208
Sequence TAAGCCATGGTGTTACTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953243264_953243273 28 Left 953243264 3:41168135-41168157 CCCTCCATCCAGGTCCTTTGAGC No data
Right 953243273 3:41168186-41168208 TAAGCCATGGTGTTACTTAGAGG No data
953243266_953243273 24 Left 953243266 3:41168139-41168161 CCATCCAGGTCCTTTGAGCCACA No data
Right 953243273 3:41168186-41168208 TAAGCCATGGTGTTACTTAGAGG No data
953243265_953243273 27 Left 953243265 3:41168136-41168158 CCTCCATCCAGGTCCTTTGAGCC No data
Right 953243273 3:41168186-41168208 TAAGCCATGGTGTTACTTAGAGG No data
953243268_953243273 14 Left 953243268 3:41168149-41168171 CCTTTGAGCCACAAGTCTAGACG No data
Right 953243273 3:41168186-41168208 TAAGCCATGGTGTTACTTAGAGG No data
953243271_953243273 6 Left 953243271 3:41168157-41168179 CCACAAGTCTAGACGGCAATGGC No data
Right 953243273 3:41168186-41168208 TAAGCCATGGTGTTACTTAGAGG No data
953243267_953243273 20 Left 953243267 3:41168143-41168165 CCAGGTCCTTTGAGCCACAAGTC No data
Right 953243273 3:41168186-41168208 TAAGCCATGGTGTTACTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953243273 Original CRISPR TAAGCCATGGTGTTACTTAG AGG Intergenic
No off target data available for this crispr