ID: 953243418

View in Genome Browser
Species Human (GRCh38)
Location 3:41169433-41169455
Sequence AAGCCCTTACTGCTAGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953243416_953243418 -1 Left 953243416 3:41169411-41169433 CCTTCTCTTCAAGCAGGAACCAA No data
Right 953243418 3:41169433-41169455 AAGCCCTTACTGCTAGTTACTGG No data
953243414_953243418 22 Left 953243414 3:41169388-41169410 CCTTAGTTATCACTGGGCTGGCT No data
Right 953243418 3:41169433-41169455 AAGCCCTTACTGCTAGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953243418 Original CRISPR AAGCCCTTACTGCTAGTTAC TGG Intergenic
No off target data available for this crispr