ID: 953243751

View in Genome Browser
Species Human (GRCh38)
Location 3:41172183-41172205
Sequence TAGGGGCCCCAGCACAGTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953243751_953243758 0 Left 953243751 3:41172183-41172205 CCCCGACTGTGCTGGGGCCCCTA No data
Right 953243758 3:41172206-41172228 TTACTGCCCTTGTAGAATCCGGG No data
953243751_953243757 -1 Left 953243751 3:41172183-41172205 CCCCGACTGTGCTGGGGCCCCTA No data
Right 953243757 3:41172205-41172227 ATTACTGCCCTTGTAGAATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953243751 Original CRISPR TAGGGGCCCCAGCACAGTCG GGG (reversed) Intergenic
No off target data available for this crispr