ID: 953243757

View in Genome Browser
Species Human (GRCh38)
Location 3:41172205-41172227
Sequence ATTACTGCCCTTGTAGAATC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953243745_953243757 9 Left 953243745 3:41172173-41172195 CCACCTGCACCCCCGACTGTGCT No data
Right 953243757 3:41172205-41172227 ATTACTGCCCTTGTAGAATCCGG No data
953243741_953243757 24 Left 953243741 3:41172158-41172180 CCTCAGGAAGATCCCCCACCTGC No data
Right 953243757 3:41172205-41172227 ATTACTGCCCTTGTAGAATCCGG No data
953243747_953243757 6 Left 953243747 3:41172176-41172198 CCTGCACCCCCGACTGTGCTGGG No data
Right 953243757 3:41172205-41172227 ATTACTGCCCTTGTAGAATCCGG No data
953243742_953243757 12 Left 953243742 3:41172170-41172192 CCCCCACCTGCACCCCCGACTGT No data
Right 953243757 3:41172205-41172227 ATTACTGCCCTTGTAGAATCCGG No data
953243752_953243757 -2 Left 953243752 3:41172184-41172206 CCCGACTGTGCTGGGGCCCCTAT No data
Right 953243757 3:41172205-41172227 ATTACTGCCCTTGTAGAATCCGG No data
953243751_953243757 -1 Left 953243751 3:41172183-41172205 CCCCGACTGTGCTGGGGCCCCTA No data
Right 953243757 3:41172205-41172227 ATTACTGCCCTTGTAGAATCCGG No data
953243744_953243757 10 Left 953243744 3:41172172-41172194 CCCACCTGCACCCCCGACTGTGC No data
Right 953243757 3:41172205-41172227 ATTACTGCCCTTGTAGAATCCGG No data
953243750_953243757 0 Left 953243750 3:41172182-41172204 CCCCCGACTGTGCTGGGGCCCCT No data
Right 953243757 3:41172205-41172227 ATTACTGCCCTTGTAGAATCCGG No data
953243743_953243757 11 Left 953243743 3:41172171-41172193 CCCCACCTGCACCCCCGACTGTG No data
Right 953243757 3:41172205-41172227 ATTACTGCCCTTGTAGAATCCGG No data
953243753_953243757 -3 Left 953243753 3:41172185-41172207 CCGACTGTGCTGGGGCCCCTATT No data
Right 953243757 3:41172205-41172227 ATTACTGCCCTTGTAGAATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953243757 Original CRISPR ATTACTGCCCTTGTAGAATC CGG Intergenic
No off target data available for this crispr