ID: 953243984

View in Genome Browser
Species Human (GRCh38)
Location 3:41174553-41174575
Sequence GCAAGGGTGACAGCTGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953243984_953243989 0 Left 953243984 3:41174553-41174575 CCAGGCACAGCTGTCACCCTTGC No data
Right 953243989 3:41174576-41174598 CTCCTCCTTTGCCAGAGTGGAGG No data
953243984_953243987 -3 Left 953243984 3:41174553-41174575 CCAGGCACAGCTGTCACCCTTGC No data
Right 953243987 3:41174573-41174595 TGCCTCCTCCTTTGCCAGAGTGG No data
953243984_953243992 7 Left 953243984 3:41174553-41174575 CCAGGCACAGCTGTCACCCTTGC No data
Right 953243992 3:41174583-41174605 TTTGCCAGAGTGGAGGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953243984 Original CRISPR GCAAGGGTGACAGCTGTGCC TGG (reversed) Intergenic
No off target data available for this crispr