ID: 953246571

View in Genome Browser
Species Human (GRCh38)
Location 3:41199308-41199330
Sequence GGTGCCCAGGCACCCCACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 810
Summary {0: 1, 1: 0, 2: 6, 3: 45, 4: 758}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953246566_953246571 -4 Left 953246566 3:41199289-41199311 CCCCGGGGAGCGTCCGTGGGGTG 0: 1
1: 0
2: 0
3: 7
4: 84
Right 953246571 3:41199308-41199330 GGTGCCCAGGCACCCCACCCCGG 0: 1
1: 0
2: 6
3: 45
4: 758
953246561_953246571 6 Left 953246561 3:41199279-41199301 CCAGCCGTCACCCCGGGGAGCGT 0: 1
1: 0
2: 0
3: 4
4: 69
Right 953246571 3:41199308-41199330 GGTGCCCAGGCACCCCACCCCGG 0: 1
1: 0
2: 6
3: 45
4: 758
953246568_953246571 -6 Left 953246568 3:41199291-41199313 CCGGGGAGCGTCCGTGGGGTGCC 0: 1
1: 0
2: 0
3: 10
4: 87
Right 953246571 3:41199308-41199330 GGTGCCCAGGCACCCCACCCCGG 0: 1
1: 0
2: 6
3: 45
4: 758
953246562_953246571 2 Left 953246562 3:41199283-41199305 CCGTCACCCCGGGGAGCGTCCGT 0: 1
1: 0
2: 0
3: 1
4: 44
Right 953246571 3:41199308-41199330 GGTGCCCAGGCACCCCACCCCGG 0: 1
1: 0
2: 6
3: 45
4: 758
953246560_953246571 9 Left 953246560 3:41199276-41199298 CCGCCAGCCGTCACCCCGGGGAG 0: 1
1: 0
2: 1
3: 18
4: 162
Right 953246571 3:41199308-41199330 GGTGCCCAGGCACCCCACCCCGG 0: 1
1: 0
2: 6
3: 45
4: 758
953246567_953246571 -5 Left 953246567 3:41199290-41199312 CCCGGGGAGCGTCCGTGGGGTGC 0: 1
1: 0
2: 0
3: 3
4: 89
Right 953246571 3:41199308-41199330 GGTGCCCAGGCACCCCACCCCGG 0: 1
1: 0
2: 6
3: 45
4: 758
953246556_953246571 24 Left 953246556 3:41199261-41199283 CCGCGCAGCGGGCAGCCGCCAGC 0: 1
1: 0
2: 2
3: 17
4: 191
Right 953246571 3:41199308-41199330 GGTGCCCAGGCACCCCACCCCGG 0: 1
1: 0
2: 6
3: 45
4: 758

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953246571 Original CRISPR GGTGCCCAGGCACCCCACCC CGG Intronic
900224942 1:1528613-1528635 GGGGCCCTGGCACCACACACCGG + Intronic
900297487 1:1959298-1959320 GGTGCCACTGCACCCCAGCCTGG - Intronic
900403462 1:2482405-2482427 GGTGCCCACTCACTGCACCCAGG - Intronic
900467252 1:2831797-2831819 GGTACTCAGGCACCCACCCCTGG - Intergenic
900626263 1:3610111-3610133 GATGCCAAGGCCCCCAACCCAGG + Intronic
900997112 1:6128671-6128693 AGTGCCCAGAGACACCACCCTGG + Intronic
901036328 1:6338383-6338405 GGTGCCCATACACCCCTTCCTGG + Intronic
901322969 1:8350516-8350538 GGTGCCCAGTCACACTGCCCTGG + Intergenic
901533394 1:9867406-9867428 GGTGCCCACGGCCCCCTCCCTGG + Intronic
901696723 1:11013051-11013073 GGTGCTCCTGCGCCCCACCCCGG + Intronic
901781697 1:11598746-11598768 GGTGCCCGGGCCCCCTGCCCTGG + Intergenic
902059688 1:13631639-13631661 GGTGCCACCGCACCCCAGCCTGG + Intergenic
902260941 1:15224346-15224368 TGTGGCCAGGCTCCCCAACCAGG - Intergenic
902409442 1:16204626-16204648 GGTGCCCTGGCAGCATACCCTGG + Intronic
902777308 1:18682973-18682995 GGTGAGCAGGGACCCCAGCCAGG - Intronic
903045184 1:20559092-20559114 GGTGCCATGGCACTCCAGCCTGG + Intergenic
903224357 1:21886454-21886476 CGCGCCCAGACACACCACCCAGG + Intronic
903444278 1:23411198-23411220 GGTGCCCCTGCACTCCAGCCTGG - Intronic
903472989 1:23600247-23600269 GGTGCCACGGCACTCCAGCCTGG + Intronic
903811421 1:26036887-26036909 GGGGCCCAGGCAGCCTTCCCAGG + Intergenic
904119691 1:28189567-28189589 GGTGCCCCTGCACTCCAACCTGG + Intronic
904235313 1:29112473-29112495 CCTGCCCAGGGACCCCTCCCAGG - Intronic
904253961 1:29242939-29242961 GGTGCCCCTGCACTCCAGCCTGG - Intronic
904376402 1:30085103-30085125 GGGGCCCAGGCCCTGCACCCTGG + Intergenic
904437373 1:30507512-30507534 GGTGCCTGGCCACCCCAGCCTGG + Intergenic
904620011 1:31769745-31769767 GGAGCCCAGGCACTCCCCCTTGG + Intergenic
905462555 1:38131078-38131100 GCTTCCCAAGAACCCCACCCAGG - Intergenic
905534908 1:38713546-38713568 GGTGCCCCTGCACTCCAGCCTGG + Intergenic
905679994 1:39863414-39863436 GGTGCCCCTGCACTCCAGCCTGG + Intronic
905681111 1:39871534-39871556 GGCGCCACTGCACCCCACCCTGG + Intronic
905985386 1:42276310-42276332 GGTGCCCCTGCACTCCAGCCTGG + Intronic
906225927 1:44121158-44121180 GGTGCCACTGCACCCCAGCCTGG - Intronic
906266298 1:44432957-44432979 GTTGCCCAGGCACTGTACCCAGG + Intronic
906306879 1:44725091-44725113 ACTGCCCTGGCACCCCAGCCGGG + Intronic
906540077 1:46578628-46578650 GGTGCCACTGCACTCCACCCTGG - Intronic
907279230 1:53334688-53334710 GGTGCCACTGCACCCCAGCCTGG - Intergenic
907458223 1:54589512-54589534 GGTGCCACTGCACCCCAGCCTGG - Intronic
908240568 1:62185667-62185689 GGTGCCACTGCACTCCACCCTGG + Intergenic
909545323 1:76840201-76840223 AGTGCCAAAGCACTCCACCCAGG - Intergenic
909587077 1:77301995-77302017 GGTGCCCCTGCACTCCACCCTGG - Intronic
910561622 1:88597851-88597873 GGTGCCCCGGCACTCTAGCCTGG + Intergenic
911021895 1:93397576-93397598 GGTGCCAATGCACTCCAGCCTGG - Intergenic
912317645 1:108680645-108680667 GGTGCCACGGCACTCCAGCCTGG + Intergenic
912474965 1:109929270-109929292 GGTGCCAAGGTATCCCAGCCTGG + Exonic
912640997 1:111346235-111346257 GTTGCCCAGGGAGTCCACCCCGG + Intergenic
913527059 1:119703631-119703653 GCTGCTCAGGCACCCCAGCCAGG - Intronic
913660929 1:121005853-121005875 GGTGCCACTGCACCCCAGCCTGG + Intergenic
914012294 1:143789017-143789039 GGTGCCACTGCACCCCAGCCTGG + Intergenic
914165539 1:145172161-145172183 GGTGCCACTGCACCCCAGCCTGG - Intergenic
914394347 1:147250625-147250647 AGTGCCCCAGCACCCCAGCCAGG - Intronic
914650923 1:149697625-149697647 GGTGCCACTGCACCCCAGCCTGG + Intergenic
914791240 1:150878932-150878954 GGTGCCCCTGCACTCCAGCCTGG + Intergenic
915155066 1:153868777-153868799 GGTGCCACTGCACTCCACCCTGG - Intronic
915327745 1:155089616-155089638 GGTGCCACTGCACCCCAGCCTGG - Intergenic
915406974 1:155667452-155667474 TGTGCCCATGCACTCCAGCCAGG + Intronic
915502157 1:156327000-156327022 TGTGCCCAGGCACCCCAGCCTGG + Intronic
915503920 1:156340200-156340222 GGTGCCTCTGCACCCCAGCCTGG - Intronic
915636317 1:157189503-157189525 TGTGCCACTGCACCCCACCCTGG - Intergenic
915766840 1:158371650-158371672 GGTGCCAGGGTACACCACCCTGG + Intergenic
915945402 1:160146874-160146896 GGTGCCACAGCACCCCAGCCTGG + Intergenic
915992681 1:160532430-160532452 TCTGCCCAGCCACCCCACCTAGG + Intergenic
916535257 1:165697985-165698007 GGTGCCCCTGCACTCCAGCCTGG + Intronic
916601089 1:166294257-166294279 GGTACCCAGTCACCCTGCCCTGG - Intergenic
917064364 1:171075827-171075849 GGTGCCAATGCACTCCAGCCTGG - Intergenic
917137080 1:171798230-171798252 GGTGCCAATGCACTCCAGCCTGG - Intronic
917532756 1:175851606-175851628 GGTGCCACTGCACCCCAGCCTGG + Intergenic
917859247 1:179129981-179130003 GGTGCCACTGCACCCCAGCCTGG - Intronic
918685021 1:187403519-187403541 GGTGCCACTGCACTCCACCCTGG + Intergenic
919249247 1:195030961-195030983 GGGGCCCAGGAACCTCCCCCTGG - Intergenic
919307175 1:195856479-195856501 AGTGCCCAGGCCTGCCACCCAGG + Intergenic
919826489 1:201507014-201507036 CGTGCCCAGGCGCCCCTCCGCGG + Intronic
920126205 1:203695527-203695549 AGTGCCCAAGCACATCACCCTGG - Intronic
920248272 1:204604853-204604875 GGTGCCACTGCACCCCAGCCCGG + Intergenic
920625758 1:207596568-207596590 GGTGCCACTGCACCCCAGCCTGG + Intronic
921239273 1:213161362-213161384 GGTGCCCCTGCACTCCACCCTGG - Intronic
922495325 1:226052819-226052841 GGTGCCACTGCACTCCACCCTGG + Intergenic
922859476 1:228803793-228803815 GGTTCCCAGCCACCGCCCCCAGG + Intergenic
922862060 1:228827464-228827486 CGTGCCACTGCACCCCACCCTGG - Intergenic
922882364 1:228990509-228990531 GGGGCCCACACACCGCACCCTGG + Intergenic
923453276 1:234139902-234139924 GGTGCCCCTGCACTCCAGCCTGG + Intronic
923548930 1:234945966-234945988 GGTGCCACTGCACCCCAGCCTGG + Intergenic
923568142 1:235092055-235092077 GGTGCCCCTGCACTCCAGCCTGG + Intergenic
923628302 1:235632127-235632149 GGTGCCGCTGCACCCCAGCCTGG - Intronic
924093164 1:240523134-240523156 CGTGCCAATGCACCCCAACCTGG - Intronic
924464878 1:244290903-244290925 GGTGCCCCTGCACTCCAGCCTGG - Intergenic
924547923 1:245047589-245047611 GGTGCCACGGCACTCCAGCCTGG + Intronic
924729735 1:246700223-246700245 GGCGCCACGGCACCCCAGCCTGG - Intergenic
924841928 1:247720677-247720699 GGAACCCACACACCCCACCCAGG + Intergenic
1062820470 10:530952-530974 GCCGACCAGACACCCCACCCTGG + Intronic
1062973378 10:1665516-1665538 AATCCCCAGGCACCCCACCCAGG + Intronic
1062979999 10:1713899-1713921 GGTCCCCAGGCATCTGACCCTGG - Intronic
1063216207 10:3927853-3927875 GGTGCCACTGCACTCCACCCTGG + Intergenic
1064420417 10:15186047-15186069 GGTGCCACTGCACTCCACCCTGG - Intergenic
1065002814 10:21352543-21352565 GGTGCCCTTGCACTCCAGCCTGG - Intergenic
1066205320 10:33183260-33183282 GGTGCCACTGCACTCCACCCTGG + Intronic
1066559995 10:36659805-36659827 GGTGCCACTGCACCCCAGCCTGG - Intergenic
1067473255 10:46550699-46550721 GGTGCCCAGGGACCCGGCTCGGG + Exonic
1068110341 10:52672717-52672739 GGCGCCCCTGCACCCCAGCCTGG + Intergenic
1068378495 10:56215336-56215358 GGTGCCAGGGCACTCCAGCCTGG + Intergenic
1068657989 10:59593921-59593943 GGTGCCAGCACACCCCACCCTGG + Intergenic
1068755479 10:60648194-60648216 GGTGCCATGGCACTCCAGCCTGG - Intronic
1068870009 10:61933025-61933047 GGTGCCAATGCACTCCAACCTGG + Intronic
1070033892 10:72702932-72702954 GGTGCCATTGCACCCCAGCCTGG + Intronic
1070243944 10:74712253-74712275 GGTGCCACGGCACTCCAGCCTGG - Intergenic
1071599886 10:86953955-86953977 TCTGCCCATGCTCCCCACCCTGG + Intronic
1072215949 10:93287220-93287242 CGTGCCCTGGCACTCCAGCCTGG + Intergenic
1072839548 10:98755950-98755972 GGTGCCACTGCACCCCAGCCTGG + Intronic
1073311371 10:102545150-102545172 GGTGCCACTGCACTCCACCCTGG - Intronic
1073387338 10:103136666-103136688 GGTGCCAATGCACTCCAGCCTGG - Intronic
1074126119 10:110530226-110530248 GGTGACCCGGCTCCCCACCGAGG + Intergenic
1074171196 10:110939260-110939282 GGTGCCACTGCACTCCACCCTGG - Intronic
1075080676 10:119381624-119381646 GGTGCCCAGGCTCCCCGGGCAGG - Intronic
1075260479 10:120959258-120959280 GGTGCCAATGCACTCCAGCCTGG - Intergenic
1076512212 10:131020957-131020979 GGGGCTCAGGCCCACCACCCAGG + Intergenic
1076559093 10:131349537-131349559 GGTGCACAGGTGGCCCACCCAGG - Intergenic
1076764652 10:132626414-132626436 CGTGACCAGGCACCTCACCTGGG - Intronic
1076834267 10:133013152-133013174 GGTGCCCAGCAACCCCAGGCAGG - Intergenic
1077147750 11:1053514-1053536 GGTGTCCAGGCAGCCTGCCCTGG - Intergenic
1077200277 11:1303431-1303453 GGTGCCCCAGCACCTCACCATGG - Intronic
1078387259 11:10903525-10903547 GGTGCCCAGGCCCCACTACCAGG - Intergenic
1079419550 11:20273341-20273363 GGTGCCACTGCACCCCAGCCTGG - Intergenic
1080280789 11:30554536-30554558 GGTGCCACTGCACTCCACCCTGG - Intronic
1080994722 11:37584458-37584480 GGTGCCCCTGCACTCCAGCCTGG + Intergenic
1082284342 11:50302650-50302672 TGTGCCACTGCACCCCACCCTGG - Intergenic
1082749623 11:57002203-57002225 CATGCCCAGGCACCCAAGCCAGG + Intergenic
1082845629 11:57723065-57723087 TGTGCCAATGCACTCCACCCTGG + Intronic
1083221951 11:61258569-61258591 GGAGCCCAGGCATCCCCACCAGG + Exonic
1083585776 11:63858068-63858090 GGTGCCACTGCACTCCACCCTGG - Intronic
1083860577 11:65418041-65418063 GGTGCCCAGGCACTCTAGCATGG + Intergenic
1084077812 11:66795343-66795365 GGTGCCCCTGCACTCCAGCCTGG - Intronic
1084147929 11:67274925-67274947 GGGGCCCATGCCCCCCACCGGGG - Intronic
1084153540 11:67302157-67302179 GGGGCCCAGGATCCCCTCCCAGG + Exonic
1084756053 11:71239501-71239523 GGTGCCAATGCACTCCAGCCTGG - Intronic
1084892287 11:72242554-72242576 GGTACCCAATCTCCCCACCCTGG + Intronic
1085023295 11:73222255-73222277 AGTGCCCAGCCACCCAGCCCTGG + Intronic
1085087729 11:73682617-73682639 GGTGCCACTGCACTCCACCCTGG + Intronic
1085416106 11:76320023-76320045 GGTGCCACTGCACTCCACCCTGG + Intergenic
1085425670 11:76402507-76402529 TGTGCCCCTGCACTCCACCCTGG + Intronic
1087645768 11:100806889-100806911 GGTGCCAACGCACTCCAGCCTGG - Intronic
1087688198 11:101289102-101289124 TGTGCCCCTGCACCCCAGCCTGG - Intergenic
1087750924 11:102006149-102006171 GGTGCCCCTGCACTCCAGCCTGG - Intergenic
1087818203 11:102682310-102682332 GGTGCCATTGCACTCCACCCTGG - Intronic
1088741447 11:112770641-112770663 TGTGCCCAGTGACCCCACCATGG - Intergenic
1088868319 11:113870116-113870138 CGTGCCAATGCACTCCACCCTGG + Intronic
1090204890 11:124878646-124878668 GGTGACCAGGCACCCTCCACTGG - Exonic
1090662080 11:128890035-128890057 GTTGCCCAGGCACCCTCCCCTGG - Intergenic
1091134832 11:133179413-133179435 GGTGCCCAGGAACAGCACCTGGG + Intronic
1091232723 11:133999045-133999067 GGGGCCCAGGCAAGCCACTCTGG + Intergenic
1091763148 12:3100979-3101001 GGAGCCCAAGCTCCACACCCGGG - Intronic
1092284191 12:7119395-7119417 GGAGCCCAGGCACCCTTCTCTGG + Intergenic
1092341370 12:7679253-7679275 GGTGCCACTGCACCCCAGCCTGG + Intergenic
1092670284 12:10854213-10854235 AGTGCCCAGGCACACTACCCAGG + Intronic
1093370140 12:18355670-18355692 CATGCCCAGGCACCCAAGCCTGG + Intronic
1095212522 12:39510269-39510291 AGTGCCCAGGCATGCCACCTGGG + Intergenic
1095307073 12:40651265-40651287 GCTGCCCACTCAACCCACCCAGG + Intergenic
1095402462 12:41830782-41830804 TGTGCCCCTGCACTCCACCCTGG + Intergenic
1095591113 12:43905097-43905119 GGTGCCATTGCACTCCACCCTGG + Intronic
1096276362 12:50211599-50211621 TGTGCCCCGGCACTCCAGCCTGG + Intronic
1096297228 12:50393960-50393982 GGTGCCAATGCACTCCAGCCTGG - Intronic
1096381613 12:51163244-51163266 GGTGCCACTGCACCCCAGCCTGG + Intronic
1096464531 12:51841037-51841059 CAGGCCCAGGCAGCCCACCCAGG + Intergenic
1096644810 12:53026643-53026665 TGTGCCAAGGCACTCCAGCCTGG - Intronic
1096788433 12:54030946-54030968 GGAGCCCAGGCGCCCGGCCCCGG + Intronic
1097171739 12:57118586-57118608 GATGGGCAGGCAGCCCACCCTGG - Intronic
1099277153 12:80591167-80591189 CGTGCCCCAGCACCCCAGCCTGG - Intronic
1100515856 12:95327233-95327255 GGTGCCACGGCACTCCAGCCTGG - Intergenic
1100776438 12:97979669-97979691 AGTGCCCAAGCACACCACTCAGG + Intergenic
1100839090 12:98593896-98593918 GGCGCCCTGGAACCCCAACCGGG - Intronic
1101434130 12:104650664-104650686 GGTGACCAGGCACCCATCCAAGG + Intronic
1101777143 12:107805807-107805829 GGGGCCAAGACAGCCCACCCTGG - Intergenic
1101859866 12:108474385-108474407 ATTGCCCAGGCACTCCAGCCTGG - Intergenic
1102263346 12:111459482-111459504 GGTGCCCCTGCACTCCAGCCTGG - Intronic
1102373366 12:112401013-112401035 GGTGCCATGGCACTCCAGCCTGG + Intergenic
1102859826 12:116326167-116326189 GGTGCCATTGCACCCCAGCCTGG - Intergenic
1103434662 12:120915535-120915557 GGTGCCCCTGCACTCCAGCCTGG - Intergenic
1103659251 12:122500590-122500612 GCTGCCCCGGCCCCACACCCGGG + Exonic
1103839536 12:123851072-123851094 GCTGCCAAGGCCCCCCACCTTGG - Exonic
1103997164 12:124837856-124837878 GGTGCCCCTGCCCCCCAGCCTGG + Intronic
1104758276 12:131282297-131282319 GCTACCCAGGAACGCCACCCAGG - Intergenic
1106290951 13:28361233-28361255 GGTGCCCCTGCACTCCAGCCTGG + Intronic
1106318296 13:28614710-28614732 GGTGCCCCTGCACTCCAGCCTGG + Intergenic
1106331093 13:28740360-28740382 GGTGCCCCTGCACTCCAGCCTGG - Intergenic
1106416422 13:29549706-29549728 GGTGCCCCTGCACTCCAGCCTGG - Intronic
1107728458 13:43323986-43324008 GGTGCCCCTGCACCCCACCTCGG - Intronic
1107832450 13:44386425-44386447 GGTGCCAATGCACTCCAGCCTGG - Intronic
1108492113 13:50992074-50992096 GGTGCCCAAGCAACCTAGCCAGG - Intergenic
1108682707 13:52793117-52793139 GGCGCCAATGCACCCCAGCCTGG + Intergenic
1108747331 13:53408990-53409012 CGGGTCCACGCACCCCACCCCGG - Intergenic
1109115971 13:58385546-58385568 GGCGCCGCTGCACCCCACCCTGG + Intergenic
1109146323 13:58784611-58784633 GGTGCCAATGCACTCCAGCCTGG - Intergenic
1109224960 13:59682363-59682385 GGTGCCACTGCACCCCAGCCTGG - Intronic
1109284869 13:60397625-60397647 GGGGCCCAGGCCCGCCGCCCGGG - Intronic
1109685409 13:65813131-65813153 GGGTCCCAGGCACCCCCACCTGG + Intergenic
1110197781 13:72810898-72810920 TGTGCCAAGGCACTCCAGCCTGG - Intronic
1110470660 13:75856134-75856156 TGGGCCCTGGCACTCCACCCTGG - Intronic
1110871331 13:80455537-80455559 GGTGCCAATGCACTCCAGCCTGG + Intergenic
1112326487 13:98445558-98445580 AGGGGCCAGGCACCCTACCCAGG - Intronic
1113463221 13:110496126-110496148 GGTGCCCAGGCTGTCCATCCAGG - Intronic
1113773199 13:112925440-112925462 GATGCCCAGGAGCCCCACGCTGG + Intronic
1113952023 13:114077422-114077444 GATGCCCAGTCCCCCCACACTGG + Intronic
1113952042 13:114077488-114077510 GATGCCCAGTCCCCCCACACTGG + Intronic
1114626691 14:24135057-24135079 GGTGCCACTGCACTCCACCCTGG + Intergenic
1114729887 14:24981312-24981334 GGTGCCACTGCACCCCAGCCTGG - Intronic
1116847979 14:49882375-49882397 TGTGCCCTGGCACTCCAGCCTGG - Intergenic
1116987303 14:51234929-51234951 AGTGTCCAGGCACTCCATCCCGG + Intergenic
1117303607 14:54451831-54451853 TGTGCCACTGCACCCCACCCTGG + Intergenic
1117560256 14:56930304-56930326 GGTGCCAATGCACTCCAGCCTGG - Intergenic
1117886413 14:60368952-60368974 GGTGCCACTGCACTCCACCCTGG + Intergenic
1118537360 14:66782787-66782809 GGTGCCACTGCACTCCACCCTGG + Intronic
1118896825 14:69952328-69952350 GGTGCCCAGGAACCTCTCCTTGG - Intronic
1119069754 14:71570828-71570850 GGTGCCACTGCACCCCAGCCTGG - Intronic
1119645680 14:76346647-76346669 TGTGCCCAGGCACCTCAACTGGG + Intronic
1119791875 14:77358078-77358100 CGTGCCAAGGCACTCCAGCCTGG + Intronic
1120901985 14:89583602-89583624 GGTGCCACTGCACTCCACCCTGG - Intronic
1121086354 14:91149201-91149223 GGTGCCATTGCACCCCAGCCTGG + Intronic
1121175430 14:91887426-91887448 GGTACCAAGGCTCTCCACCCAGG + Intronic
1121723537 14:96129504-96129526 GCTGCCCAGGCCACTCACCCAGG + Intergenic
1122088113 14:99320866-99320888 AGGACCCGGGCACCCCACCCAGG + Intergenic
1122233349 14:100318345-100318367 GTTGCCCAAGCAACCAACCCGGG - Intergenic
1122266496 14:100549251-100549273 GCTGCACAGGGACCCCTCCCAGG + Intronic
1122641898 14:103164901-103164923 CATGCCCAAGCACCCCAGCCAGG - Intergenic
1122794807 14:104200843-104200865 GGTGCCCAGGTGCCCGAGCCTGG - Intergenic
1122806549 14:104262885-104262907 GGTGTCAGGGCCCCCCACCCTGG + Intergenic
1122881033 14:104690472-104690494 GGGGCTCAAGCTCCCCACCCAGG + Intronic
1123936373 15:25196077-25196099 GACGCTCAGGGACCCCACCCCGG - Intergenic
1124130943 15:26985181-26985203 GCTGCCCACACACCCCACCTGGG + Intronic
1124622305 15:31280634-31280656 GGGGCTCAGGCACCCCACCCAGG - Intergenic
1124636856 15:31371108-31371130 GGTGCCAGAGCCCCCCACCCTGG + Intronic
1125031892 15:35082394-35082416 TCTGCCCAGCCACCCCACCTGGG + Intergenic
1125802629 15:42463754-42463776 CGTGCCACGGCACCCCAGCCTGG + Intronic
1126375474 15:47992600-47992622 GGTGCCACTGCACCCCAGCCTGG + Intergenic
1126452294 15:48821768-48821790 TGTGCCCTGGCACTCCAGCCTGG - Intergenic
1126649174 15:50904618-50904640 GGTGCCACGGCACTCCAGCCTGG - Intergenic
1126663187 15:51052188-51052210 GGGGTCCTGGCAGCCCACCCAGG - Intergenic
1126716960 15:51527676-51527698 GGTGCCACTGCACTCCACCCTGG + Intronic
1126828116 15:52571348-52571370 GGTGCCACTGCACCCCAGCCTGG - Intergenic
1126864168 15:52919730-52919752 GGTGCCTATGGACCCAACCCAGG - Intergenic
1127218825 15:56854957-56854979 GGTGCCTCTGCACCCCAGCCTGG + Intronic
1127407154 15:58662374-58662396 TGTGCCATGGCACCCCAGCCCGG - Intronic
1127606360 15:60591984-60592006 GGTCCCCAGGGCCCGCACCCGGG - Intronic
1128450849 15:67805129-67805151 GATGCCAAGGCACTCAACCCCGG - Intronic
1129089611 15:73135302-73135324 TGTGCCCAGCTACCACACCCAGG + Intronic
1129229055 15:74186562-74186584 TGTGCCACGGCACTCCACCCTGG + Intronic
1129296909 15:74604667-74604689 GGGTCCCAAGCTCCCCACCCTGG - Intronic
1129374782 15:75122596-75122618 GGTGCCACTGCACCCCAGCCTGG - Intergenic
1129460747 15:75698949-75698971 GTCTCCCAGGCAGCCCACCCTGG - Intronic
1129468671 15:75738395-75738417 GGTGCCCTCGCGCCCCTCCCGGG - Intergenic
1129724118 15:77893091-77893113 GTCTCCCAGGCAGCCCACCCTGG + Intergenic
1129806820 15:78468284-78468306 GGTGCCACGGCACCTCAGCCTGG - Intronic
1130343660 15:83021696-83021718 GGTGACCCGGCACTCCATCCTGG + Intronic
1130829207 15:87582567-87582589 GGTGCCCAGGAGTGCCACCCTGG + Intergenic
1131171421 15:90181456-90181478 GGTGCCCCTGCACTCCAGCCTGG + Intronic
1131973032 15:97911632-97911654 GGTGCCAATGCACTCCAGCCTGG - Intergenic
1132100480 15:99019443-99019465 GGTGCCACGGCACTCCAGCCTGG + Intergenic
1132514241 16:358944-358966 TGTGCCAAGGCACTCCAGCCTGG + Intergenic
1132690735 16:1180815-1180837 GGTCCACAGCCACCCCGCCCTGG + Intronic
1132885251 16:2179561-2179583 GTTGCCCCTTCACCCCACCCTGG + Intronic
1133060738 16:3172955-3172977 GGTGCCAATGCACTCCAGCCTGG - Intergenic
1133169606 16:3973540-3973562 GGTGTCCTTGCACCCCAGCCTGG - Intronic
1133648065 16:7783163-7783185 GGTGCCACGGCACTCCAGCCTGG - Intergenic
1134179356 16:12034965-12034987 CGTGCCCTGGCACTCCAGCCTGG + Intronic
1134652380 16:15920107-15920129 TGTGCCACTGCACCCCACCCTGG - Intergenic
1135638389 16:24098704-24098726 GGTGCCACGGCACTCCAGCCTGG + Intronic
1136224328 16:28848392-28848414 GGTGCCACTGCACTCCACCCTGG + Intronic
1136282622 16:29222660-29222682 GGTCCCCAGGCACCACTGCCAGG + Intergenic
1137327594 16:47457265-47457287 GATGCCAAGGCACTCCAGCCTGG + Intronic
1137586096 16:49664662-49664684 GCTCCCCACCCACCCCACCCAGG - Intronic
1137754089 16:50887800-50887822 GCAGCCAAGGCCCCCCACCCAGG - Intergenic
1137959073 16:52863264-52863286 AGTGCCCAGGCATCCAGCCCAGG + Intergenic
1138496107 16:57410331-57410353 AGTGGCCAGGCACACCACCCAGG - Intronic
1138564704 16:57824637-57824659 GGTGCCCCTGCACTCCACCCTGG + Intronic
1139234853 16:65327121-65327143 GGTGCCGTGGCACTCCATCCTGG - Intergenic
1139434275 16:66927073-66927095 GGGGCACAGGCAGCCCAGCCAGG - Intergenic
1139490783 16:67284903-67284925 GGTGTCCTGGCACCGCGCCCAGG - Exonic
1139490963 16:67285802-67285824 GGTGTCCTGGCACCGCACTCAGG - Intronic
1140441776 16:74993395-74993417 GGTGCCCCTGCACTCCAGCCTGG + Intronic
1140657609 16:77156594-77156616 GGTGCCACTGCACCCCAGCCTGG + Intergenic
1140738454 16:77920038-77920060 GGTGCCCCTGCACTCCAGCCTGG + Intronic
1140796355 16:78442091-78442113 GGTGCCCCTGCACTCCATCCTGG + Intronic
1140869137 16:79090720-79090742 GGGGCCCAGGCATGCCACCAAGG + Intronic
1140883445 16:79220210-79220232 GGTGCCAATGCACTCCAGCCTGG + Intergenic
1141969522 16:87471615-87471637 GGTGCCAAGACATCCCACCAGGG + Intronic
1141985811 16:87579100-87579122 GGTGCCATCGCACCCCAGCCTGG + Intergenic
1142086996 16:88188585-88188607 GGTCCCCAGGCACCACTGCCAGG + Intergenic
1142514126 17:415949-415971 GGTGCCACTGCACTCCACCCTGG + Intronic
1142617512 17:1144972-1144994 GGTGCCACGGCACTCCAGCCTGG + Intronic
1142666561 17:1467150-1467172 AGAGCCCAGGCACCTCACCATGG - Intronic
1142855670 17:2728272-2728294 GGTGCCATGGCACTCCAGCCTGG + Intergenic
1143222845 17:5276862-5276884 GGTGCCCTGGCCCCACTCCCTGG + Intergenic
1143270151 17:5669332-5669354 GGTGCCCAGGTACCTGACCCTGG - Intergenic
1143516762 17:7423171-7423193 GGCGCCCCTGCACCCCAGCCTGG + Intergenic
1144728290 17:17512606-17512628 GGTGTCCAGGCTCTCCATCCTGG + Exonic
1144756715 17:17683915-17683937 TGTGCCAAGGCACTCCAGCCTGG - Intronic
1144839067 17:18174564-18174586 GGTGCCAATGCACTCCAGCCTGG + Intronic
1144840916 17:18185005-18185027 TGTGCTCAGGTAACCCACCCGGG + Exonic
1145360196 17:22205579-22205601 GGTGCCACTGCACCCCAGCCTGG + Intergenic
1146103253 17:30006691-30006713 TGTGCCAATGCACCCCAGCCTGG - Intronic
1146970435 17:37067645-37067667 GGTGGCCAGGAACCCCACCCCGG + Intergenic
1147316238 17:39621737-39621759 CCTGCCCAGGCACCCGGCCCCGG - Intergenic
1147456935 17:40543696-40543718 GGTGACCAGACCTCCCACCCTGG + Intergenic
1147862631 17:43532734-43532756 TGTGCCCATTGACCCCACCCTGG + Exonic
1148610602 17:48962111-48962133 GGTGCCCCTGCACTCCAGCCTGG - Intronic
1148907894 17:50922880-50922902 TGGGCCCAGGCTCTCCACCCAGG - Intergenic
1149529753 17:57385605-57385627 AGTGCCGTTGCACCCCACCCTGG + Intronic
1149669490 17:58393361-58393383 GGTGCCACTGCACCCCAGCCTGG + Intronic
1149693240 17:58596137-58596159 GGTGCCACTGCACTCCACCCTGG + Intronic
1149832193 17:59882325-59882347 GGTGCCACTGCACCCCAGCCTGG - Intronic
1150048878 17:61939428-61939450 GGTGCCACTGCACCCCAGCCTGG + Intergenic
1150079280 17:62222431-62222453 GGTGCCATGGCACTCCAGCCTGG - Intergenic
1150283570 17:63943392-63943414 GATGTCCAGACACCCTACCCAGG - Intronic
1150961883 17:69922782-69922804 TGTGCCACTGCACCCCACCCTGG - Intergenic
1150975700 17:70084105-70084127 GGTGCTCAGGCGACCCACGCAGG - Intronic
1151009144 17:70473162-70473184 AGTGCACATGCACACCACCCAGG + Intergenic
1151338865 17:73456947-73456969 GGTGCCTAGGCACCACACCTGGG + Intronic
1151351836 17:73536480-73536502 GGTGCCCAGGTGGCCCAGCCTGG - Intronic
1151605253 17:75131507-75131529 GGGGCGCAGGGTCCCCACCCGGG - Intronic
1151804889 17:76399131-76399153 GGTGCACAGGAAGCTCACCCAGG + Intronic
1151811208 17:76443330-76443352 CGTGCCCCGGCACTCCAGCCTGG - Intronic
1151815738 17:76470557-76470579 GGGGACCTGTCACCCCACCCGGG - Intergenic
1151853044 17:76702462-76702484 TGTGCCAATGCACCCCAGCCTGG + Intronic
1151910283 17:77078337-77078359 GGTGCCAATGCACTCCAGCCTGG + Intergenic
1151915633 17:77115960-77115982 GGTGCCAATGCACTCCAGCCTGG - Intronic
1152135589 17:78501437-78501459 GCTGCCCAGGGAACCCTCCCTGG + Intronic
1152357406 17:79813737-79813759 GGGGCCCCTGCAGCCCACCCGGG + Intergenic
1152391150 17:80004716-80004738 GGTGCCCCTGCACTCCAGCCTGG - Intronic
1152700598 17:81816776-81816798 GGTGCCATTGCACTCCACCCTGG + Intergenic
1152794898 17:82302005-82302027 GGTCCCCAGCCACCACCCCCAGG + Intergenic
1152824044 17:82452880-82452902 GGTGCCACTGCACCCCAGCCTGG - Intergenic
1153012767 18:554578-554600 CGTGCCCATGCACTCCAGCCTGG + Intergenic
1153219661 18:2850447-2850469 GGTGCCACTGCACCCCAGCCTGG - Intronic
1154062971 18:11080798-11080820 GGTGCCACTGCACCCCAGCCTGG + Intronic
1154227577 18:12521373-12521395 CGTGCCACTGCACCCCACCCAGG - Intronic
1154290617 18:13102854-13102876 CGGGCCCAGGCATCACACCCTGG + Intronic
1154929290 18:20975652-20975674 GGTGCCACGGCACTCCATCCTGG - Intronic
1156371567 18:36476176-36476198 GGAGGCCAGGCACCACAACCAGG - Intronic
1156522259 18:37731796-37731818 GGTGCCCAGGCCCGACTCCCAGG + Intergenic
1158975432 18:62707093-62707115 GGTGCCACTGCACCCCAGCCTGG + Intergenic
1158985218 18:62808594-62808616 GGTGCCATTGCACCCCAGCCTGG - Intronic
1159202649 18:65206924-65206946 GGGTCCCAGGCACCCCTGCCAGG + Intergenic
1159769163 18:72528014-72528036 GGTGCCATTGCACTCCACCCTGG - Intergenic
1160531406 18:79567142-79567164 GGTGCCCGGGCACCCACCCCTGG + Intergenic
1160596212 18:79976196-79976218 GGTGCCACTGCACTCCACCCTGG + Intronic
1160705618 19:528873-528895 AGTTCCCAGGGCCCCCACCCTGG - Intergenic
1160785075 19:896573-896595 GGTGCGGAGGCCCCCCAGCCTGG + Exonic
1160828168 19:1090278-1090300 GGAGCCCACCCACCCCACCCTGG + Intronic
1160913296 19:1484666-1484688 GGTGCCCCGCCACCATACCCGGG - Intronic
1160956265 19:1693424-1693446 GGTGCCACTGCACCCCAGCCTGG - Intergenic
1160985161 19:1835214-1835236 GGTGCCCTGGGAGCCCACCCAGG + Intronic
1160988965 19:1852868-1852890 GGATCCCAGGCACCCATCCCTGG + Exonic
1161120136 19:2521220-2521242 GGTGCCCCTGCACTCCAGCCTGG + Intronic
1161974630 19:7601360-7601382 TGTGCCCCGGCACTCCAGCCTGG - Intronic
1161987492 19:7664508-7664530 GGTGCCCTTGCACTCCAGCCTGG - Intergenic
1162073106 19:8166774-8166796 GGTGCCATTGCACCCCAGCCTGG - Intronic
1162567599 19:11453012-11453034 TGGGCCCATCCACCCCACCCTGG + Exonic
1162662806 19:12183639-12183661 GGTGCCAATGCACTCCAACCTGG - Intronic
1162717852 19:12645138-12645160 TGTCCCCTGGCACCCCACCCTGG + Intronic
1163084698 19:14971084-14971106 GGTGCCACTGCACCCCAGCCTGG + Intronic
1163178859 19:15584510-15584532 TGTGCCCAGGACCCCCATCCCGG - Intergenic
1163667927 19:18611806-18611828 GGTGCGCCGGGCCCCCACCCGGG + Intronic
1163696933 19:18768800-18768822 GGCCCCGAGGGACCCCACCCTGG - Intronic
1163710664 19:18844977-18844999 CGTGCCCATGCACCCCAGCCAGG + Intronic
1163957650 19:20659281-20659303 GGTGCCAAGGCACTCCAGCCTGG - Intronic
1164564203 19:29314478-29314500 GGGGCCCAGGCAAGCCTCCCAGG - Intergenic
1164580558 19:29432608-29432630 GGCCACCAGTCACCCCACCCAGG + Intergenic
1165005936 19:32806699-32806721 GGTGCCACTGCACCCCAGCCTGG - Intronic
1165425571 19:35743641-35743663 GGTGCCAATGCACTCCAGCCTGG + Intronic
1165560556 19:36676108-36676130 GGTGCCACTGCACTCCACCCTGG - Intergenic
1165649434 19:37472696-37472718 GGTGCCATGGCACTCCAGCCTGG + Intronic
1167124154 19:47538087-47538109 GGTCCGCAGGCAATCCACCCTGG + Intronic
1167301305 19:48679514-48679536 TGTGCCCCCGCACCCCAGCCTGG - Intergenic
1167516763 19:49928045-49928067 GGTGCCCAGGCCCCATCCCCTGG - Exonic
1167725414 19:51209112-51209134 GGTGCCATGGCACTCCAGCCTGG + Intergenic
1167797722 19:51720534-51720556 GGTGCCACTGCACCCCAGCCTGG - Intronic
1167841983 19:52129825-52129847 GGTGCCACTGCACCCCAGCCTGG - Intronic
1168373181 19:55853434-55853456 GATGCCACGGCACTCCACCCTGG - Intronic
1168565046 19:57415619-57415641 GATGCCCAGCAACCCCATCCAGG - Intronic
925205664 2:2003578-2003600 GGTGCCAAGGCACCCACCCCAGG - Intronic
925468452 2:4133380-4133402 GGTGCACAGACACCCCACTGTGG - Intergenic
925489804 2:4378295-4378317 GGTGCCACTGCACTCCACCCTGG + Intergenic
925771393 2:7285904-7285926 GGTGCCACTGCACCCCAGCCTGG + Intergenic
925779235 2:7365453-7365475 TGTGCCCCGGCACTCCAGCCTGG + Intergenic
925915701 2:8603837-8603859 GGCGCCCATGCACTCCAGCCTGG + Intergenic
926308726 2:11659232-11659254 GGTGACCAGGAACCACAGCCAGG - Intronic
927324096 2:21783090-21783112 GCTTCCCAGGCAACACACCCAGG - Intergenic
927553485 2:24017601-24017623 GGTGGCAAGGCCCCCCAACCTGG + Intronic
927777587 2:25914347-25914369 GGTGCCACTGCACTCCACCCCGG - Intergenic
928087844 2:28356815-28356837 GCTGCCCAGGCCTCCCTCCCTGG + Intergenic
928150702 2:28826178-28826200 GGTGCCAATGCACTCCAGCCTGG - Intronic
928358309 2:30641059-30641081 GGTGCCCAGGCTCCCTCCCTTGG + Exonic
928785818 2:34884942-34884964 GGTGCCACTGCACTCCACCCTGG - Intergenic
928965573 2:36971736-36971758 GGTGCCAGGGCACTCCAGCCTGG - Intronic
929477289 2:42264149-42264171 GGTGCCATGGCACTCCAGCCTGG - Intronic
929698737 2:44142945-44142967 GGTGCCACTGCACTCCACCCTGG + Intergenic
930417296 2:51104654-51104676 GGTGCCACTGCACTCCACCCTGG - Intergenic
930748694 2:54911471-54911493 GGTGCCCCTGCACTCCAGCCTGG - Intronic
931620356 2:64204146-64204168 CCTGCCCAGGCTCCCAACCCAGG - Intergenic
932364383 2:71139002-71139024 GTTGCCCAGGCTGCCCACGCTGG - Intronic
932516277 2:72353413-72353435 GGTGCCAATGCACTCCAGCCTGG - Intronic
934043362 2:88148084-88148106 GGTGCTCAGCCACACCACTCAGG + Intergenic
934168748 2:89321422-89321444 TCTGCCCAGGCATCCCAGCCTGG + Intergenic
934198542 2:89861161-89861183 TCTGCCCAGGCATCCCAGCCTGG - Intergenic
934500748 2:94858350-94858372 GGCGCCCAGGCACCGGCCCCAGG + Intergenic
934786088 2:97007687-97007709 GGTGCCAGGGCACTCCAGCCTGG - Intronic
934790837 2:97058767-97058789 TCTGCCCAGGCATCCCAGCCTGG - Intergenic
934815617 2:97323763-97323785 TCTGCCCAGGCATCCCAGCCTGG + Intergenic
934822078 2:97384720-97384742 TCTGCCCAGGCATCCCAGCCTGG - Intergenic
935112136 2:100104222-100104244 GGCGGCCACGCATCCCACCCGGG + Intronic
935634769 2:105241992-105242014 GTTGCCCAGGAACCCCACCACGG - Exonic
936122839 2:109760929-109760951 GGCGGCCACGCATCCCACCCGGG - Intergenic
936168188 2:110142383-110142405 GGTGCCACTGCACCCCAGCCTGG - Intronic
936221850 2:110610535-110610557 GGCGGCCACGCATCCCACCCGGG + Intergenic
936280457 2:111135677-111135699 GGTGCCCAGACACCCAAGGCTGG + Intronic
936519703 2:113204028-113204050 GCTGCCCAGGCACCTCTGCCTGG + Intronic
938240200 2:129737614-129737636 GGTGCCCACACTCACCACCCAGG + Intergenic
939424867 2:142022712-142022734 GGTGCCACGGCACTCCAGCCTGG - Intronic
940331949 2:152484716-152484738 GGTGCCCCTGCACTCCAGCCTGG + Intronic
940582848 2:155602753-155602775 GGTGCCATTGCACCCCAGCCTGG - Intergenic
940856875 2:158735830-158735852 GGTGCCACTGCACCCCAGCCTGG + Intergenic
940927211 2:159377766-159377788 GGTGCCCCTGCACTCCAGCCTGG + Intronic
943714669 2:191137287-191137309 TGTGCCAAGGCACTCCAGCCTGG + Intronic
944101995 2:196036882-196036904 GGTGCCCATGCATGCCACCCAGG + Intronic
944322944 2:198369550-198369572 GGTGCCCATGCATCCCAAACGGG + Intronic
944582477 2:201143904-201143926 GGCGCCACTGCACCCCACCCTGG + Intronic
944673948 2:202019584-202019606 GGTGCCAATGCACTCCAGCCTGG + Intergenic
944677855 2:202049166-202049188 GGTGCCACTGCACCCCAGCCTGG + Intergenic
944808044 2:203301967-203301989 GGTGCCATGGCACTCCAGCCTGG - Intronic
944840027 2:203615915-203615937 GGTGCCACGGCACTCCAGCCCGG - Intergenic
945393818 2:209297744-209297766 GGTGCCACTGCACCCCAGCCTGG + Intergenic
945493786 2:210485186-210485208 GGTGCCACGGCACTCCAGCCTGG + Intronic
946018136 2:216620566-216620588 TGTGCCCCTGCACCCCAGCCTGG + Intergenic
946255489 2:218438733-218438755 AGGGCCCAGCCACCCCGCCCCGG - Intronic
946741656 2:222808371-222808393 GGTGCCACTGCACCCCAGCCTGG + Intergenic
947596234 2:231413386-231413408 AGTGCCCATGCACTCCAGCCTGG + Intergenic
948118975 2:235514747-235514769 GGTGCTCAGGAACCAAACCCCGG + Intronic
948220087 2:236262594-236262616 CGTGCCCAAGCACCCCCCCGAGG - Intronic
948608566 2:239152409-239152431 AGGGACCAGGCACCTCACCCTGG + Intronic
948801234 2:240434574-240434596 GGCTCCCAGACCCCCCACCCCGG - Intergenic
949046997 2:241876863-241876885 GGCGGCCAGGCTGCCCACCCAGG - Intergenic
1168775006 20:440113-440135 GGTGTCCAGGGACACCAGCCTGG + Intronic
1169208019 20:3750688-3750710 GGTGCCCAGGCACTTCTGCCTGG + Intronic
1170312993 20:15012852-15012874 GGTGCACAGGAAACCCACCCAGG - Intronic
1170441036 20:16378926-16378948 GCTGCAGAGGCACTCCACCCTGG - Exonic
1170557978 20:17530988-17531010 GGTGCCCTGGCGCTCCAGCCGGG + Exonic
1170626272 20:18032548-18032570 GGTGCCACTGCACCCCAGCCTGG - Intronic
1170934623 20:20798887-20798909 GGTGCCACTGCACCCCAGCCTGG + Intergenic
1171503625 20:25614941-25614963 GGTGCCATGGCACTCCAACCTGG + Exonic
1171949449 20:31407819-31407841 GGTGCCACGGCACTCCAGCCTGG - Intronic
1171978329 20:31609429-31609451 GGTGCCACCGCACCCCAGCCTGG - Intergenic
1172149513 20:32780171-32780193 CTTGCCCAAGTACCCCACCCAGG - Intronic
1172167313 20:32907171-32907193 GGTTCCCAGGTAGCCCAGCCTGG + Intronic
1172196120 20:33092675-33092697 GCTGCCCAGCCACCTCCCCCTGG - Intronic
1172921429 20:38486011-38486033 GGTGCCATTGCACCCCAGCCTGG - Intronic
1173937737 20:46881759-46881781 GGTGCCCAGGGACTCTACGCTGG - Intergenic
1174204291 20:48827914-48827936 GGCGTCCAGGCGCCCCATCCCGG + Intergenic
1174401191 20:50276865-50276887 GCTGCCCAGGCCCCCAACCTGGG + Intergenic
1175134660 20:56814082-56814104 GGTGCCAATGCACTCCAGCCTGG - Intergenic
1175288908 20:57860172-57860194 GGTGCCCAGGCACCCCATATTGG - Intergenic
1175702322 20:61148913-61148935 GGTGCCACGGCACTCCAGCCTGG - Intergenic
1175798229 20:61785605-61785627 GGTGGACAGGGCCCCCACCCAGG + Intronic
1175819085 20:61898842-61898864 GGTGCCCAGACCCCCATCCCAGG + Intronic
1175835404 20:61990629-61990651 GGTGGCCAGGCTGCCCTCCCTGG - Intronic
1175950298 20:62580107-62580129 GGGGCCAAGTCACGCCACCCAGG - Intergenic
1176046162 20:63093869-63093891 GGTGCCATTGCACCCCAGCCTGG + Intergenic
1176081902 20:63277707-63277729 GCTACCCAGTCACCCCACCCGGG - Intronic
1176107158 20:63394858-63394880 GGACCCCGGGCACCACACCCAGG - Intergenic
1176550045 21:8217070-8217092 GGTGCCCGGGCCCCCCTCGCGGG - Intergenic
1176568972 21:8400105-8400127 GGTGCCCGGGCCCCCCTCGCGGG - Intergenic
1176576886 21:8444340-8444362 GGTGCCCGGGCCCCCCTCGCGGG - Intergenic
1176654137 21:9574877-9574899 GGAGCCCAGGCACCCAGCTCTGG + Intergenic
1178275180 21:31230566-31230588 CATGCCCAGGCACTCCAGCCTGG - Intronic
1178352782 21:31884820-31884842 GGTGCCACTGCACCCCAGCCTGG - Intronic
1178408898 21:32347766-32347788 CATCCTCAGGCACCCCACCCTGG - Exonic
1179680515 21:43017784-43017806 GGTGCCCGAGTAGCCCACCCAGG + Intronic
1179800061 21:43807486-43807508 GGTGCCCCTGCACTCCAGCCTGG - Intergenic
1179881899 21:44296502-44296524 GGCACCCAGGCTCCCCACTCTGG + Intronic
1179888037 21:44322771-44322793 GGTGCCCAGGCGGCTCACGCTGG + Intronic
1180842444 22:18965659-18965681 GGTCCCTGGGCACCCCACTCTGG - Intergenic
1180989545 22:19926735-19926757 GGTGCCACTGCACCCCAGCCTGG + Intronic
1180999698 22:19982306-19982328 CCTGCCCCGGCACCCCATCCTGG + Intronic
1181281797 22:21725953-21725975 GGTGCCCCTGCACTCCAGCCTGG + Intronic
1181290733 22:21791061-21791083 GGTGCCACGGTACCCCAGCCTGG + Intronic
1181610301 22:24007375-24007397 TGTGCCCAGGCCCCACTCCCTGG + Intergenic
1182239833 22:28907024-28907046 GGTGCCCCTGCACTCCAGCCTGG - Intronic
1182345429 22:29660611-29660633 GGTGCCCCGGCACTCCAGCCTGG - Intronic
1183055429 22:35302377-35302399 GGTGCCATTGCACCCCAGCCTGG - Intronic
1183896593 22:40974447-40974469 GGTGCCAATGCACTCCAGCCTGG - Intergenic
1185244589 22:49766166-49766188 GGTCCCCATGCACCCTGCCCTGG - Intergenic
1185278170 22:49958752-49958774 GGCGGGCAGGCACCCCACCCTGG - Intergenic
1185339324 22:50284506-50284528 GGTGACCCCCCACCCCACCCGGG + Intronic
1203254935 22_KI270733v1_random:133396-133418 GGTGCCCGGGCCCCCCTCGCGGG - Intergenic
1203262991 22_KI270733v1_random:178475-178497 GGTGCCCGGGCCCCCCTCGCGGG - Intergenic
949518673 3:4830015-4830037 GGTGCCAATGCACTCCAGCCTGG - Intronic
950484947 3:13267659-13267681 GGTGCCCCTGCACTCCAGCCTGG - Intergenic
950517852 3:13479462-13479484 GGAGCCCAGGGATCCCAGCCCGG + Intergenic
950967312 3:17155205-17155227 GGTCTCCTGGCACCCCTCCCAGG + Intergenic
951210294 3:19967186-19967208 GGTGCCATGGCACTCCAGCCTGG - Intronic
951470073 3:23046278-23046300 GGTGCCAATGCACTCCACCCTGG + Intergenic
952005648 3:28839416-28839438 CGTGCCCAGGCACTGCAACCTGG + Intergenic
952444802 3:33370657-33370679 GGTGCCACTGCACTCCACCCTGG - Intronic
953246571 3:41199308-41199330 GGTGCCCAGGCACCCCACCCCGG + Intronic
953314746 3:41916430-41916452 GGTGCCACTGCACTCCACCCTGG - Intronic
953996978 3:47527334-47527356 GGTGCCACTGCACTCCACCCTGG - Intergenic
954221402 3:49156623-49156645 GGTGCCACTGCACCCCAGCCTGG + Intergenic
954223021 3:49166106-49166128 CGCGCCCAGCGACCCCACCCTGG - Intronic
954417651 3:50401527-50401549 GGATACCAGGCTCCCCACCCTGG - Intronic
954458339 3:50611924-50611946 GGGGCCCGCGCACCCCGCCCGGG - Exonic
954875695 3:53801646-53801668 GGTCCCTCGGCACCCCACACAGG - Intronic
956229592 3:66998553-66998575 GGTACCCAGCCTCCCCATCCCGG - Intronic
956358527 3:68420301-68420323 GGTGCCATGGCACACCACCTGGG - Intronic
956587795 3:70882725-70882747 GGTGCCACGGCACTCCAGCCTGG + Intergenic
957177815 3:76834406-76834428 GGTGCCCCTGCACTCCAGCCTGG - Intronic
957456404 3:80454359-80454381 GGTGCCACTGCACCCCAGCCTGG + Intergenic
958406703 3:93762831-93762853 TCTGCCCAGGCACCCCATCTGGG - Intergenic
958406715 3:93762868-93762890 TCTGCCCAGGCACCCCATCTGGG - Intergenic
958406727 3:93762905-93762927 TCTGCCCAGGCACCCCATCTGGG - Intergenic
958430896 3:94039454-94039476 GGTGCCAATGCACTCCAGCCTGG + Intronic
958447573 3:94234104-94234126 GGTGCCACTGCACCCCAGCCTGG + Intergenic
959549205 3:107635754-107635776 GGTGCCACTGCACCCCAGCCTGG - Intronic
959846913 3:111043492-111043514 TGTGCCCATGCACTCCAGCCTGG - Intergenic
960192800 3:114727192-114727214 GGAGCCCAGGCCCACCAACCTGG + Intronic
960910833 3:122647712-122647734 GGTGCCACGGCACTCCAGCCTGG + Intergenic
961902943 3:130232055-130232077 GGTGCCATGGCACTCCAGCCTGG + Intergenic
961936155 3:130585996-130586018 TGTGCCCCTGCACCCCAGCCTGG - Intronic
962034012 3:131631937-131631959 GGTGCCATGGCACTCCAGCCTGG - Intronic
962204621 3:133424677-133424699 TGTGCCAAGGCACTCCAGCCTGG - Intronic
963034831 3:141016810-141016832 TGTGCCACGGCACCCCAGCCTGG + Intergenic
963523087 3:146380723-146380745 GGGTCACAGGCACCCCACCTGGG - Intergenic
963829684 3:149993252-149993274 AGTGCCCAGGCACGCCATTCAGG + Intronic
966365970 3:179187679-179187701 GGTGCCACTGCACTCCACCCTGG - Intronic
966608847 3:181848309-181848331 GGTGCCACTGCACCCCAGCCTGG + Intergenic
966619343 3:181946880-181946902 GGTGCCACTGCACCCCAGCCTGG + Intergenic
966757745 3:183387219-183387241 GGTGCCACTGCACCCCAGCCTGG + Intronic
967460879 3:189744464-189744486 AGTGCCCAGGAACACCATCCAGG + Intronic
968008227 3:195257181-195257203 GGTGCCCAGCCATCCCACCCCGG + Intronic
968297017 3:197584517-197584539 GGTGCCACTGCACCCCAGCCTGG - Intergenic
968327882 3:197836719-197836741 CGTGCCAAGGCACACCAGCCTGG - Intronic
968473183 4:791274-791296 GGCGCCCTGGCATCCCACCCAGG - Intronic
968589143 4:1449086-1449108 GGTCCCCAGGAGCCCCAGCCAGG + Intergenic
968669905 4:1843672-1843694 GGGGGACAGGCACCCCACCTCGG + Intronic
968703720 4:2068808-2068830 GCTGCCCAGGCCCTCCACCCAGG - Exonic
968799033 4:2729947-2729969 GGTGCCCCCGCACTCCAGCCTGG - Intronic
968878207 4:3285444-3285466 GAGGCCCAGCCACGCCACCCTGG - Intergenic
968884922 4:3323194-3323216 GGCGCCACGGCACCCCTCCCGGG - Intronic
968960273 4:3739831-3739853 GCTGCCCACGCACCTCAGCCCGG - Intergenic
969034363 4:4241045-4241067 GTTGCCCAGGCACTCCAGGCTGG - Intronic
969225170 4:5791838-5791860 AATGCCCAGACACCCCGCCCTGG + Intronic
969290111 4:6233425-6233447 CCTGCCCAGGGACGCCACCCAGG + Intergenic
970381431 4:15511811-15511833 TGTGCCCAAACACCACACCCAGG + Intronic
970817849 4:20179099-20179121 CCTGCCCAGCCACCCCACCATGG - Intergenic
970898652 4:21132967-21132989 GGTGCCACTGCACCCCAGCCTGG + Intronic
972011473 4:34188944-34188966 GGTGCCACTGCACCCCAGCCGGG - Intergenic
972331076 4:38064972-38064994 GGTGCCCCTGCACTCCAGCCTGG - Intronic
973114924 4:46443999-46444021 GGTGCCACTGCACTCCACCCTGG + Intronic
973978292 4:56284679-56284701 GGTGCCACTGCACCCCAGCCTGG + Intronic
975415259 4:74098400-74098422 AGTGCCCAGGGTCACCACCCAGG - Intronic
975598320 4:76071958-76071980 GGTGCCACTGCACCCCAGCCTGG - Intronic
976949379 4:90810599-90810621 TGTGCCAAGGCACTCCAGCCTGG + Intronic
977220532 4:94332512-94332534 GGGTCGCAGGCACCCCAACCTGG + Intronic
978781639 4:112561955-112561977 GGTGCCATTGCACCCCAGCCTGG - Intronic
979188165 4:117824605-117824627 GGTCACCAGGCACCCCCACCCGG + Intergenic
980173108 4:129313050-129313072 GGTGCCAATGCACCCCAGCCTGG - Intergenic
981717233 4:147763796-147763818 GGTGCCACTGCACCCCAGCCTGG - Intronic
982158505 4:152543675-152543697 GGTGCCAGGGCACTCCAGCCTGG + Intergenic
984623439 4:181978601-181978623 GGTGCCACGGCACTCCAGCCTGG + Intergenic
984919749 4:184753039-184753061 GCTCCCCAGGGACCCCTCCCAGG - Intergenic
985581337 5:696624-696646 GCTTCCCAGGCCCCACACCCAGG - Intergenic
985595966 5:787956-787978 GCTTCCCAGGCCCCACACCCAGG - Intergenic
985634371 5:1028677-1028699 GGCGCCTAGGCACCCCAAACCGG + Intronic
985666275 5:1183023-1183045 GGTGCCCAGGGAGTCCACGCTGG + Intergenic
985820002 5:2153257-2153279 GGTGCCCAAGCCCACCATCCTGG - Intergenic
986344633 5:6823098-6823120 GGTTCCCAGGTCCCCCACTCTGG - Intergenic
988994379 5:36700704-36700726 TGTGCCAAGGCACACCAGCCTGG + Intergenic
989050294 5:37313542-37313564 GGTGCCACTGCACCCCAGCCTGG - Intronic
990299726 5:54437996-54438018 GCTGCCCAGGGAACCCACCTTGG + Intergenic
990336184 5:54774984-54775006 GCCGCCCTGCCACCCCACCCTGG + Intergenic
990941258 5:61205239-61205261 TCTGCCCAGCCACCCCACCTGGG + Intergenic
991321715 5:65381404-65381426 GGTGCCCTTGCACTCCAGCCTGG - Intronic
991422537 5:66455799-66455821 TGTGCCCATGCACTCCAGCCTGG + Intergenic
991944157 5:71883509-71883531 GATGCCCAGGCCCCACACCAAGG + Intergenic
992223222 5:74593153-74593175 AGTGCCCATGCACTCCAGCCTGG - Intergenic
992223272 5:74593464-74593486 GGTGCCATGGCACTCCAGCCTGG - Intergenic
992554334 5:77888746-77888768 GGTGCCAATGCACTCCAGCCTGG - Intergenic
992611204 5:78510030-78510052 GGAGCCCTACCACCCCACCCTGG - Exonic
992687435 5:79212168-79212190 GGTGCCACTGCACTCCACCCTGG + Intronic
992796629 5:80259445-80259467 GGTGCCATTGCACCCCAGCCTGG + Intergenic
992849277 5:80788757-80788779 AGTGCCCATGCACTCCAGCCTGG + Intronic
993840092 5:92866953-92866975 GGTGCCAACGCACTCCAGCCTGG - Intergenic
995887173 5:116908551-116908573 GGTGCACAGGCACTCCTCACTGG - Intergenic
996753986 5:126917046-126917068 GGTGCAGTGGCATCCCACCCTGG - Intronic
997103696 5:130995235-130995257 GCTCCACAGGCACCCGACCCCGG + Intergenic
997125255 5:131220248-131220270 GGTGCCACGGCACTCCAGCCTGG - Intergenic
997260650 5:132463288-132463310 GGTGCCCTGGCTCCCAAGCCAGG - Exonic
997294534 5:132761398-132761420 TGTGGCCAGACACACCACCCTGG - Intronic
997510749 5:134452217-134452239 TCTGCCCAGTCACCCCTCCCTGG + Intergenic
998037721 5:138930977-138930999 GGGGCTCAGGCAGCCCAGCCTGG + Intronic
998078060 5:139252509-139252531 CGTGCCACTGCACCCCACCCTGG - Intronic
998156900 5:139792252-139792274 CCTACCCAGGCACCCCACCTGGG + Intergenic
999673691 5:153978505-153978527 GGTGCCAAAGCACTCCAGCCTGG + Intergenic
1000031143 5:157402284-157402306 AGTGCCCAAGCACACCATCCAGG + Intronic
1000362729 5:160462917-160462939 CGTGCCACGGCACCCCAGCCTGG - Intergenic
1001197884 5:169690095-169690117 GGTGCCACTGCACCCCAGCCTGG - Intronic
1002214574 5:177621014-177621036 GGTGCCACTGCACTCCACCCTGG - Intergenic
1002329027 5:178428978-178429000 GCTGCCCAGGCCCAGCACCCGGG + Intronic
1002374440 5:178778236-178778258 GGTGCCAGTGCACCCCAGCCTGG + Intergenic
1002494759 5:179604131-179604153 GGTGGCCAGGCAGCTCACACTGG - Intronic
1002543770 5:179924743-179924765 GGTGCCACTGCACTCCACCCTGG + Intronic
1002638267 5:180618693-180618715 CGTGATCAGGCACCCCAGCCTGG - Intronic
1002788497 6:421936-421958 GGTGCCATGGCACTCCAGCCTGG - Intergenic
1003481141 6:6534562-6534584 GGCGTCCAGGCACCGCGCCCAGG + Intergenic
1003502946 6:6717236-6717258 GGTGCCCCGGGGCCCCACTCAGG + Intergenic
1004221658 6:13752509-13752531 GGTGCCATGGCACTCCAGCCTGG + Intergenic
1004374410 6:15079046-15079068 GGTGCCACTGCACTCCACCCTGG + Intergenic
1004996754 6:21200747-21200769 GGGGCCCAGGAGCCCCTCCCAGG + Intronic
1005248468 6:23915960-23915982 GGTGCCAATGCACCCCTGCCTGG + Intergenic
1005399291 6:25415204-25415226 GGTGCCACTGCACCCCAGCCTGG - Intronic
1005652919 6:27901225-27901247 GGTGCCATGGCACTCCAGCCTGG + Intergenic
1006937604 6:37729233-37729255 GTGGCACAAGCACCCCACCCAGG + Intergenic
1007740170 6:44005080-44005102 GGCGCCCAGGCATTCCTCCCAGG + Exonic
1007810884 6:44484985-44485007 GATGCCACGGGACCCCACCCAGG + Intergenic
1008208629 6:48694022-48694044 AGTGTCCAGGCACCCCAGGCAGG - Intergenic
1009316773 6:62229602-62229624 GGGGCCCAGGCTCCCAACCATGG - Intronic
1011597041 6:89026036-89026058 GGTGCCACGGCACTCCAGCCTGG - Intergenic
1012405084 6:98886838-98886860 TGTTCCAAGCCACCCCACCCAGG - Intronic
1012912838 6:105136978-105137000 GCTGCCCAGGCTCCCCGCCAGGG - Exonic
1013399479 6:109778424-109778446 GGTGCCACGGCACTCCAACCTGG + Intronic
1013569621 6:111408558-111408580 GGTGCCACTGCACCCCAGCCTGG + Intronic
1013588249 6:111598136-111598158 AGAGCCCAGGCCCCACACCCAGG + Intronic
1014244130 6:119049402-119049424 GGTGCCATTGCACCCCAGCCTGG + Intronic
1014330747 6:120060459-120060481 GGTGCCATTGCACCCCAGCCTGG + Intergenic
1014551389 6:122792675-122792697 TGGGCCAAGGCACTCCACCCTGG - Intronic
1015732260 6:136360983-136361005 GGTGCGGCCGCACCCCACCCTGG - Exonic
1015883530 6:137893018-137893040 GGTGCCATTGCACCCCAGCCTGG - Intergenic
1017539419 6:155385143-155385165 GGAGCCCAGGGACATCACCCAGG - Intergenic
1018403076 6:163445656-163445678 GGTGCCCCTGCACTCCAGCCTGG - Intronic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1019578654 7:1749513-1749535 GGTGCCCGTGGAGCCCACCCGGG - Intergenic
1020143959 7:5628564-5628586 GGTGCCACTGCACCCCAGCCTGG - Intronic
1021486061 7:21169738-21169760 GGTCCTCGGGCACCCCTCCCAGG - Intergenic
1021878768 7:25073583-25073605 GGTGGCCAAGCTCCCCAGCCTGG - Intergenic
1023227016 7:37981354-37981376 GGTGCCCTTGCACTCCAGCCTGG - Intronic
1023928314 7:44687457-44687479 TGTGCCCCTGCACCCCAGCCTGG - Intronic
1024225939 7:47327063-47327085 GATGCCCAGGAGGCCCACCCTGG + Intronic
1024282770 7:47733130-47733152 GGTGCCACTGCACCCCAGCCTGG + Intronic
1025280487 7:57623551-57623573 GGAGCCCAGGCACCCAGCCCTGG + Intergenic
1025304244 7:57841956-57841978 GGAGCCCAGGCACCCAGCCCTGG - Intergenic
1025719436 7:63996554-63996576 GGTGCCACTGCACTCCACCCTGG + Intergenic
1026144138 7:67731179-67731201 GGTGCCAATGGACCCCAGCCTGG - Intergenic
1026255592 7:68708604-68708626 GGTGCCACTGCACTCCACCCTGG - Intergenic
1026680514 7:72463163-72463185 CGTGCCAATGCACCCCAGCCTGG - Intergenic
1026768383 7:73174772-73174794 GGTGCCCAGGCAACTCTCCCAGG - Intergenic
1026829742 7:73603369-73603391 GGAGCCCAGCCACCCCCACCTGG - Intronic
1026833115 7:73622067-73622089 GGTGCCACTGCACTCCACCCTGG - Intronic
1026840615 7:73668297-73668319 GGTGCACAGGCGCCCCCCTCGGG - Intronic
1026858464 7:73769990-73770012 GGTGCCCAGCCAGCCCAGCACGG + Exonic
1027078790 7:75217879-75217901 GGTGCCCAGGCAACTCTCCCAGG + Intergenic
1027239221 7:76316442-76316464 GGTGCCATGGCACTCCAGCCTGG - Intergenic
1028262935 7:88686626-88686648 GGTCCCCGCGCACCCTACCCGGG + Intergenic
1028470928 7:91205837-91205859 TGTGCCACGGCACCCCAGCCTGG - Intronic
1029115448 7:98234194-98234216 TGTGCCCCTGCACCCCAGCCTGG - Intronic
1029362978 7:100100682-100100704 GGATCCCAGGCACGCCCCCCCGG + Intronic
1029536593 7:101160999-101161021 GGGGTCCAGGCTCCCCTCCCAGG - Exonic
1029544901 7:101205529-101205551 TGTGCCCCGGCACTCCAGCCTGG - Intergenic
1030081689 7:105784003-105784025 GGTGCCACTGCACTCCACCCTGG - Intronic
1032086526 7:128886755-128886777 GTGGCACAGGCCCCCCACCCAGG - Intronic
1032669421 7:134069539-134069561 GGTGCCAATGCACTCCAGCCGGG - Intergenic
1033200873 7:139368692-139368714 GGTGCCAATGCACTCCAGCCTGG + Intronic
1033206321 7:139426096-139426118 GGTGCCACTGCACCCCAGCCTGG + Intergenic
1033328233 7:140397154-140397176 GGTGCCACGGCACTCCAGCCTGG + Intronic
1034433847 7:151053873-151053895 CGGGCTCAGGCACCCCACCCCGG + Exonic
1034782966 7:153898406-153898428 GGTGCCACGGCACTCCAGCCTGG + Intronic
1035234854 7:157489609-157489631 GGTGCCACTGCACCCCAGCCTGG + Intergenic
1035407044 7:158605862-158605884 GGTGCCACTGCACCCCAGCCTGG + Intergenic
1035450504 7:158974212-158974234 GGTGCCCAGGCCCCACCCACGGG - Intergenic
1036047781 8:5163177-5163199 GGTGCCACGGCACTCCAGCCTGG + Intergenic
1036624295 8:10453914-10453936 GGTGTCCCTGCACCCCAGCCTGG - Intergenic
1036673733 8:10811712-10811734 GGTGCCCAGGCAAGCCCCCGTGG - Intronic
1036852661 8:12215027-12215049 GGTGCCAAGGCACTCCAGCATGG - Intergenic
1036874032 8:12457549-12457571 GGTGCCAAGGCACTCCAGCATGG - Intergenic
1037221130 8:16523070-16523092 GGTGCCACTGCACCCCAGCCTGG + Intronic
1037390352 8:18386563-18386585 GGTGCCCATACACCCCACCCCGG + Intergenic
1037695886 8:21223551-21223573 GGTGCCACTGCACTCCACCCTGG + Intergenic
1037755821 8:21709581-21709603 GGCCCCCAGGCACACTACCCCGG - Intronic
1037776869 8:21841281-21841303 GGTGCCGATCCACCCCGCCCTGG + Intergenic
1038173978 8:25164282-25164304 GGTGCCACTGCACCCCAGCCTGG + Intergenic
1038417821 8:27410177-27410199 GCTTCCCAGGAACCCCACCTGGG - Intronic
1038435387 8:27532140-27532162 GGGGCCCAGGCACCACCCCCAGG - Intronic
1038940492 8:32298981-32299003 GGTGCCAATGCACTCCAGCCTGG + Intronic
1039013799 8:33124209-33124231 GGTGCCATTGCACCCCAGCCTGG - Intergenic
1039221355 8:35334554-35334576 GGTGCCATTGCACCCCAGCCTGG - Intronic
1039717539 8:40126581-40126603 GGTGCCAATGCACTCCAGCCTGG - Intergenic
1039848673 8:41343848-41343870 GGTGCCAATGCACTCCAGCCTGG - Intergenic
1040282689 8:46073119-46073141 GGTGCCATGGCACTCCAGCCTGG - Intergenic
1040402940 8:47071098-47071120 GGTGCCATGGCACTCCAGCCTGG - Intergenic
1040663738 8:49605200-49605222 GGTTTGCAGGCACCCCAACCTGG + Intergenic
1040901521 8:52422109-52422131 GGTGCCACTGCACTCCACCCTGG - Intronic
1041388367 8:57327779-57327801 GGTGCCATTGCACTCCACCCTGG + Intergenic
1041475979 8:58266381-58266403 GGTGCCCCTGCACTCCAGCCTGG + Intergenic
1042159471 8:65877746-65877768 GGTGGCCATGCAGCCCTCCCGGG - Intergenic
1042232721 8:66575008-66575030 GGTGCCATTGCACCCCAGCCTGG + Intronic
1043392274 8:79803340-79803362 GGTGCCAATGCACTCCAGCCTGG + Intergenic
1044236437 8:89836377-89836399 GGTGCCATTGCACCCCAGCCTGG - Intergenic
1044462760 8:92465165-92465187 GGTGGCCAGGTTCCCCACTCTGG + Intergenic
1045432046 8:102123805-102123827 GGTGCCCCGGCCCCCGGCCCCGG + Intronic
1045500356 8:102739925-102739947 GGGGCCCAGGCATCCCCTCCGGG + Intergenic
1046312141 8:112451580-112451602 GGTGCCATTGCACTCCACCCTGG - Intronic
1046645383 8:116780599-116780621 GGTGCCCCTGCACTCCAGCCTGG - Intronic
1047928647 8:129704675-129704697 GGTCCCCAGGCCCTCCAACCTGG + Intergenic
1047991286 8:130289140-130289162 GGTGCCACGGCACTCCAGCCTGG + Intronic
1048328627 8:133457236-133457258 GGAGGCCAGGCAACCGACCCAGG + Exonic
1048427687 8:134338118-134338140 CTTGCCCTGGCTCCCCACCCAGG + Intergenic
1049213907 8:141399077-141399099 GATTCCCCGCCACCCCACCCAGG + Intronic
1049374320 8:142281762-142281784 AGTGCCCAGTGACCCCGCCCAGG - Intronic
1049426030 8:142538257-142538279 GGTGCCCAGCCACCTCACAGTGG + Intronic
1049571381 8:143371766-143371788 GGTGCCCTGACACCCCACTGTGG - Intronic
1049789544 8:144466497-144466519 GGAGCCCGGGGACCCCGCCCAGG + Exonic
1050231023 9:3526075-3526097 GCCGCCCCGCCACCCCACCCGGG - Intergenic
1050302450 9:4273547-4273569 GGTGCCAATGCACTCCATCCTGG + Intronic
1051637056 9:19190319-19190341 TGTGCCCATGCACTCCAGCCTGG + Intergenic
1051641707 9:19230346-19230368 GGTGCTCAGGCCCCTCCCCCGGG - Intergenic
1052122089 9:24730561-24730583 GGGTCACAGGCACCCCAACCTGG - Intergenic
1052289029 9:26821844-26821866 GGTGCCACTGCACCCCAGCCTGG - Intergenic
1052303245 9:26976207-26976229 GGTCTTCAGTCACCCCACCCAGG - Intronic
1053521592 9:38785597-38785619 CGTGCCCCTGCACCCCAGCCTGG - Intergenic
1053656434 9:40222199-40222221 GGCACCCAGGCACCCGCCCCAGG - Intergenic
1053906783 9:42851417-42851439 GGCGCCCAGGCACCCGCCCCAGG - Intergenic
1054193758 9:62009586-62009608 CGTGCCCCTGCACCCCAGCCTGG - Intergenic
1054356844 9:64070640-64070662 GGTGCCCAGGCACCGGCCTCAGG - Intergenic
1054368539 9:64368421-64368443 GGCGCCCAGGCACCCGCCCCAGG - Intergenic
1054528183 9:66154086-66154108 GGCGCCCAGGCACCCGCCCCAGG + Intergenic
1054644649 9:67579105-67579127 CGTGCCCCTGCACCCCAGCCTGG + Intergenic
1054676164 9:67858173-67858195 GGCACCCAGGCACCCGCCCCAGG - Intergenic
1055298653 9:74860381-74860403 GTTGCCCAGGCATTCCAGCCTGG + Intronic
1055551439 9:77435311-77435333 GGTGCCAAGGCACTCCAGCCTGG + Intronic
1056043789 9:82695549-82695571 GGTGCCCAAGTACACCATCCAGG - Intergenic
1056059615 9:82870508-82870530 GGGTCACAGGCACCCCAACCTGG + Intergenic
1056592735 9:87976496-87976518 TGTGCCAAGGCACTCCACCCTGG + Intergenic
1056640389 9:88365219-88365241 GGTGCCACTGCACCCCAGCCTGG + Intergenic
1056758626 9:89398689-89398711 GGGTCACAGGCACCCCAACCTGG + Intronic
1057359184 9:94357749-94357771 GGTGCCACTGCACCCCAGCCTGG + Intergenic
1057545314 9:96015757-96015779 TGTGCCCCTGCACCCCAGCCTGG + Intergenic
1057564554 9:96156303-96156325 GGTGGCTAGTCACCCCATCCTGG - Intergenic
1057648577 9:96899841-96899863 GGTGCCACTGCACCCCAGCCTGG - Intronic
1057831341 9:98409543-98409565 TGCGCCCAGACACCCCACCCAGG + Intronic
1057958560 9:99432989-99433011 GGTGCCCAGTCACCCAACCCAGG + Intergenic
1058283451 9:103146895-103146917 TGTGCCCATGCACTCCAGCCTGG - Intergenic
1058293575 9:103276110-103276132 GGTGCCCCTGCACTCCAGCCTGG + Intergenic
1058294135 9:103284181-103284203 GGTGCCATGGCACTCCAGCCTGG + Intergenic
1059197459 9:112383743-112383765 GGTGCCAATGCACCCCAGCCTGG - Intronic
1060299910 9:122369123-122369145 GGTGCCGAGGCAGCCCTCCAGGG - Intergenic
1060827609 9:126695729-126695751 ACTCCCCAGGCACCCCACTCTGG - Intronic
1061017881 9:127993095-127993117 GGTGCCATTGCACCCCAGCCTGG - Intergenic
1061194226 9:129098714-129098736 GGTACCCATCCTCCCCACCCTGG - Intronic
1061720464 9:132547884-132547906 CTTGCCCAGGCAGCCCTCCCTGG + Intronic
1061797175 9:133092980-133093002 CGTGCCACGGCACCCCAGCCTGG + Intergenic
1061826148 9:133259525-133259547 GGTGCCAATGCACTCCAGCCTGG + Intronic
1061901468 9:133674322-133674344 GGTGCACACGCACCCAACCCTGG - Intronic
1062152078 9:135025445-135025467 GGTGCCACGGCACTCCAGCCGGG - Intergenic
1062218495 9:135402059-135402081 GGTGCCCTTGCACTCCAGCCTGG + Intergenic
1062368034 9:136221222-136221244 GGCACACAGGCACCCCACGCAGG + Intronic
1062400832 9:136371916-136371938 GGTGCTCAGCGACCCCAACCTGG - Exonic
1062435598 9:136545463-136545485 GGGGCCCCAGCACCCCACACCGG + Intronic
1203771412 EBV:51727-51749 GGAGGCCAGGCCCCCCACCGTGG - Intergenic
1203471337 Un_GL000220v1:116542-116564 GGTGCCCGGGCCCCCCTCGCGGG - Intergenic
1203479158 Un_GL000220v1:160514-160536 GGTGCCCGGGCCCCCCTCGCGGG - Intergenic
1203631860 Un_KI270750v1:78335-78357 GGAGCCCAGGCACCCAGCTCTGG + Intergenic
1185574887 X:1163555-1163577 GGTGCCCCTGCACTCCAGCCTGG + Intergenic
1186741620 X:12524109-12524131 TGTGCCCCTGCACCCCAGCCTGG + Intronic
1186876604 X:13824167-13824189 GATGCCCAGGAGCACCACCCCGG + Intronic
1187914248 X:24138462-24138484 GGTGCCAATGCACTCCAGCCTGG + Intergenic
1187933987 X:24318352-24318374 GGTGCACAGGCACCTGGCCCAGG + Intergenic
1187986872 X:24823443-24823465 GGTGCCACGGCACTCCAGCCTGG - Intronic
1188770682 X:34149619-34149641 GGTGCCACTGCACTCCACCCTGG - Intergenic
1189228111 X:39430480-39430502 GGTGCCAGGGCACTCCAGCCTGG + Intergenic
1189323401 X:40098989-40099011 GCTGCCCAGGCCCCTCGCCCCGG + Intronic
1190617226 X:52246773-52246795 TGTGCCATGGCACCCCAGCCTGG - Intergenic
1190707882 X:53045708-53045730 GGTGCCTCTGCACTCCACCCTGG + Intergenic
1191255140 X:58276427-58276449 GGAGCCCCCGCACCCAACCCAGG - Intergenic
1191255934 X:58279647-58279669 GCAGCCCCCGCACCCCACCCAGG - Intergenic
1191961099 X:66703031-66703053 AATGCCCATGCACCCCATCCAGG + Intergenic
1192418025 X:71002018-71002040 GGTGCCCCTGCACTCCAGCCTGG + Intergenic
1192658942 X:73022029-73022051 TGTGCCCAGCCACCCCGCCTGGG - Intergenic
1192818793 X:74621250-74621272 GGTGCCAATGCACTCCAGCCTGG - Intergenic
1194090594 X:89579304-89579326 GATTCCCAATCACCCCACCCGGG - Intergenic
1194286527 X:92017659-92017681 GGTGCCACGGCACTCCAGCCTGG + Intronic
1194673917 X:96770152-96770174 GGTGCCACTGCACCCCAGCCTGG + Intronic
1194872275 X:99147005-99147027 GGTGCCCACACACACCACCAGGG + Intergenic
1195722251 X:107878190-107878212 GGGGCCCAGGGACCCCACACGGG - Intronic
1195750968 X:108161777-108161799 GGTCCCCAGGCACCTTCCCCAGG + Intronic
1195810706 X:108825486-108825508 GGTGGGCAGTCACCTCACCCAGG - Intergenic
1195998931 X:110760315-110760337 GGGACCCAGTCGCCCCACCCAGG - Intronic
1196203496 X:112912748-112912770 GGTGCCCCTGCACCCCAGCCTGG - Intergenic
1196919142 X:120567828-120567850 GGTGCCAATGCACTCCAGCCTGG + Intronic
1196928556 X:120658566-120658588 GGTGCCAATGCACTCCAGCCTGG - Intergenic
1197785961 X:130197248-130197270 GGTGCCCCTGCACTCCAGCCTGG - Intergenic
1198174669 X:134143631-134143653 GGTGCCACTGCACTCCACCCTGG - Intergenic
1198400365 X:136262791-136262813 GGTGCCCCTGCACTCCAGCCTGG + Intergenic
1198683414 X:139204558-139204580 AGTGCGCGGGCAGCCCACCCAGG - Intronic
1198845170 X:140902479-140902501 CGTGCCACGGCACTCCACCCTGG - Intergenic
1199264863 X:145818126-145818148 GGCGCCCAGCCTCCCCACGCTGG - Intronic
1199396632 X:147346031-147346053 GGTGCCATTGCACCCCAGCCTGG + Intergenic
1200131631 X:153851604-153851626 GGTGCCATTGCACTCCACCCTGG - Intergenic
1200256944 X:154587610-154587632 GGTGCCACTGCACCCCAGCCTGG + Intergenic
1200260825 X:154616792-154616814 GGTGCCACTGCACCCCAGCCTGG - Intergenic
1200443247 Y:3235364-3235386 GATTCCCAATCACCCCACCCGGG - Intergenic
1200604072 Y:5242216-5242238 GGTGCCACGGCACTCCAGCCTGG + Intronic
1200683413 Y:6239535-6239557 GGTGCCAATGCACTCCAGCCTGG + Intergenic
1201049221 Y:9914850-9914872 GGTGCCAATGCACTCCAGCCTGG - Intergenic
1201149104 Y:11085702-11085724 GGAGCCCAGGCTGCACACCCTGG + Intergenic
1202301391 Y:23419551-23419573 GGTGCCAATGCACTCCATCCTGG - Intergenic
1202569420 Y:26251047-26251069 GGTGCCAATGCACTCCATCCTGG + Intergenic