ID: 953246593

View in Genome Browser
Species Human (GRCh38)
Location 3:41199385-41199407
Sequence AGGGGCGGGGCGCGAGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2793
Summary {0: 2, 1: 2, 2: 30, 3: 301, 4: 2458}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953246593_953246599 -10 Left 953246593 3:41199385-41199407 CCGCCCCCTCGCGCCCCGCCCCT 0: 2
1: 2
2: 30
3: 301
4: 2458
Right 953246599 3:41199398-41199420 CCCCGCCCCTTGTCCTCGCGCGG 0: 1
1: 0
2: 3
3: 14
4: 108
953246593_953246609 19 Left 953246593 3:41199385-41199407 CCGCCCCCTCGCGCCCCGCCCCT 0: 2
1: 2
2: 30
3: 301
4: 2458
Right 953246609 3:41199427-41199449 GCTCCGCGCTGCGCCGGTGGCGG 0: 1
1: 0
2: 0
3: 15
4: 118
953246593_953246611 23 Left 953246593 3:41199385-41199407 CCGCCCCCTCGCGCCCCGCCCCT 0: 2
1: 2
2: 30
3: 301
4: 2458
Right 953246611 3:41199431-41199453 CGCGCTGCGCCGGTGGCGGCAGG 0: 1
1: 0
2: 2
3: 21
4: 228
953246593_953246608 16 Left 953246593 3:41199385-41199407 CCGCCCCCTCGCGCCCCGCCCCT 0: 2
1: 2
2: 30
3: 301
4: 2458
Right 953246608 3:41199424-41199446 AACGCTCCGCGCTGCGCCGGTGG 0: 1
1: 0
2: 0
3: 0
4: 25
953246593_953246607 13 Left 953246593 3:41199385-41199407 CCGCCCCCTCGCGCCCCGCCCCT 0: 2
1: 2
2: 30
3: 301
4: 2458
Right 953246607 3:41199421-41199443 CGGAACGCTCCGCGCTGCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 38
953246593_953246602 -7 Left 953246593 3:41199385-41199407 CCGCCCCCTCGCGCCCCGCCCCT 0: 2
1: 2
2: 30
3: 301
4: 2458
Right 953246602 3:41199401-41199423 CGCCCCTTGTCCTCGCGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953246593 Original CRISPR AGGGGCGGGGCGCGAGGGGG CGG (reversed) Intronic