ID: 953246597 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:41199391-41199413 |
Sequence | AGGACAAGGGGCGGGGCGCG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 422 | |||
Summary | {0: 1, 1: 0, 2: 3, 3: 44, 4: 374} |
Found 5 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
953246597_953246611 | 17 | Left | 953246597 | 3:41199391-41199413 | CCTCGCGCCCCGCCCCTTGTCCT | 0: 1 1: 0 2: 3 3: 44 4: 374 |
||
Right | 953246611 | 3:41199431-41199453 | CGCGCTGCGCCGGTGGCGGCAGG | 0: 1 1: 0 2: 2 3: 21 4: 228 |
||||
953246597_953246609 | 13 | Left | 953246597 | 3:41199391-41199413 | CCTCGCGCCCCGCCCCTTGTCCT | 0: 1 1: 0 2: 3 3: 44 4: 374 |
||
Right | 953246609 | 3:41199427-41199449 | GCTCCGCGCTGCGCCGGTGGCGG | 0: 1 1: 0 2: 0 3: 15 4: 118 |
||||
953246597_953246607 | 7 | Left | 953246597 | 3:41199391-41199413 | CCTCGCGCCCCGCCCCTTGTCCT | 0: 1 1: 0 2: 3 3: 44 4: 374 |
||
Right | 953246607 | 3:41199421-41199443 | CGGAACGCTCCGCGCTGCGCCGG | 0: 1 1: 0 2: 0 3: 2 4: 38 |
||||
953246597_953246608 | 10 | Left | 953246597 | 3:41199391-41199413 | CCTCGCGCCCCGCCCCTTGTCCT | 0: 1 1: 0 2: 3 3: 44 4: 374 |
||
Right | 953246608 | 3:41199424-41199446 | AACGCTCCGCGCTGCGCCGGTGG | 0: 1 1: 0 2: 0 3: 0 4: 25 |
||||
953246597_953246613 | 26 | Left | 953246597 | 3:41199391-41199413 | CCTCGCGCCCCGCCCCTTGTCCT | 0: 1 1: 0 2: 3 3: 44 4: 374 |
||
Right | 953246613 | 3:41199440-41199462 | CCGGTGGCGGCAGGATACAGCGG | 0: 1 1: 0 2: 0 3: 7 4: 106 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
953246597 | Original CRISPR | AGGACAAGGGGCGGGGCGCG AGG (reversed) | Intronic | ||