ID: 953246601

View in Genome Browser
Species Human (GRCh38)
Location 3:41199400-41199422
Sequence CGCCGCGCGAGGACAAGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 64}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953246601_953246607 -2 Left 953246601 3:41199400-41199422 CCGCCCCTTGTCCTCGCGCGGCG 0: 1
1: 0
2: 0
3: 8
4: 64
Right 953246607 3:41199421-41199443 CGGAACGCTCCGCGCTGCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 38
953246601_953246611 8 Left 953246601 3:41199400-41199422 CCGCCCCTTGTCCTCGCGCGGCG 0: 1
1: 0
2: 0
3: 8
4: 64
Right 953246611 3:41199431-41199453 CGCGCTGCGCCGGTGGCGGCAGG 0: 1
1: 0
2: 2
3: 21
4: 228
953246601_953246608 1 Left 953246601 3:41199400-41199422 CCGCCCCTTGTCCTCGCGCGGCG 0: 1
1: 0
2: 0
3: 8
4: 64
Right 953246608 3:41199424-41199446 AACGCTCCGCGCTGCGCCGGTGG 0: 1
1: 0
2: 0
3: 0
4: 25
953246601_953246609 4 Left 953246601 3:41199400-41199422 CCGCCCCTTGTCCTCGCGCGGCG 0: 1
1: 0
2: 0
3: 8
4: 64
Right 953246609 3:41199427-41199449 GCTCCGCGCTGCGCCGGTGGCGG 0: 1
1: 0
2: 0
3: 15
4: 118
953246601_953246613 17 Left 953246601 3:41199400-41199422 CCGCCCCTTGTCCTCGCGCGGCG 0: 1
1: 0
2: 0
3: 8
4: 64
Right 953246613 3:41199440-41199462 CCGGTGGCGGCAGGATACAGCGG 0: 1
1: 0
2: 0
3: 7
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953246601 Original CRISPR CGCCGCGCGAGGACAAGGGG CGG (reversed) Intronic