ID: 953246606

View in Genome Browser
Species Human (GRCh38)
Location 3:41199411-41199433
Sequence GCGGAGCGTTCCGCCGCGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 35}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953246606_953246608 -10 Left 953246606 3:41199411-41199433 CCTCGCGCGGCGGAACGCTCCGC 0: 1
1: 0
2: 1
3: 3
4: 35
Right 953246608 3:41199424-41199446 AACGCTCCGCGCTGCGCCGGTGG 0: 1
1: 0
2: 0
3: 0
4: 25
953246606_953246613 6 Left 953246606 3:41199411-41199433 CCTCGCGCGGCGGAACGCTCCGC 0: 1
1: 0
2: 1
3: 3
4: 35
Right 953246613 3:41199440-41199462 CCGGTGGCGGCAGGATACAGCGG 0: 1
1: 0
2: 0
3: 7
4: 106
953246606_953246609 -7 Left 953246606 3:41199411-41199433 CCTCGCGCGGCGGAACGCTCCGC 0: 1
1: 0
2: 1
3: 3
4: 35
Right 953246609 3:41199427-41199449 GCTCCGCGCTGCGCCGGTGGCGG 0: 1
1: 0
2: 0
3: 15
4: 118
953246606_953246611 -3 Left 953246606 3:41199411-41199433 CCTCGCGCGGCGGAACGCTCCGC 0: 1
1: 0
2: 1
3: 3
4: 35
Right 953246611 3:41199431-41199453 CGCGCTGCGCCGGTGGCGGCAGG 0: 1
1: 0
2: 2
3: 21
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953246606 Original CRISPR GCGGAGCGTTCCGCCGCGCG AGG (reversed) Intronic