ID: 953246609

View in Genome Browser
Species Human (GRCh38)
Location 3:41199427-41199449
Sequence GCTCCGCGCTGCGCCGGTGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 118}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953246594_953246609 16 Left 953246594 3:41199388-41199410 CCCCCTCGCGCCCCGCCCCTTGT 0: 1
1: 0
2: 6
3: 29
4: 305
Right 953246609 3:41199427-41199449 GCTCCGCGCTGCGCCGGTGGCGG 0: 1
1: 0
2: 0
3: 15
4: 118
953246598_953246609 6 Left 953246598 3:41199398-41199420 CCCCGCCCCTTGTCCTCGCGCGG 0: 1
1: 0
2: 1
3: 9
4: 82
Right 953246609 3:41199427-41199449 GCTCCGCGCTGCGCCGGTGGCGG 0: 1
1: 0
2: 0
3: 15
4: 118
953246593_953246609 19 Left 953246593 3:41199385-41199407 CCGCCCCCTCGCGCCCCGCCCCT 0: 2
1: 2
2: 30
3: 301
4: 2458
Right 953246609 3:41199427-41199449 GCTCCGCGCTGCGCCGGTGGCGG 0: 1
1: 0
2: 0
3: 15
4: 118
953246592_953246609 22 Left 953246592 3:41199382-41199404 CCACCGCCCCCTCGCGCCCCGCC 0: 2
1: 1
2: 22
3: 302
4: 2098
Right 953246609 3:41199427-41199449 GCTCCGCGCTGCGCCGGTGGCGG 0: 1
1: 0
2: 0
3: 15
4: 118
953246600_953246609 5 Left 953246600 3:41199399-41199421 CCCGCCCCTTGTCCTCGCGCGGC 0: 1
1: 0
2: 0
3: 19
4: 168
Right 953246609 3:41199427-41199449 GCTCCGCGCTGCGCCGGTGGCGG 0: 1
1: 0
2: 0
3: 15
4: 118
953246601_953246609 4 Left 953246601 3:41199400-41199422 CCGCCCCTTGTCCTCGCGCGGCG 0: 1
1: 0
2: 0
3: 8
4: 64
Right 953246609 3:41199427-41199449 GCTCCGCGCTGCGCCGGTGGCGG 0: 1
1: 0
2: 0
3: 15
4: 118
953246596_953246609 14 Left 953246596 3:41199390-41199412 CCCTCGCGCCCCGCCCCTTGTCC 0: 1
1: 0
2: 2
3: 67
4: 627
Right 953246609 3:41199427-41199449 GCTCCGCGCTGCGCCGGTGGCGG 0: 1
1: 0
2: 0
3: 15
4: 118
953246603_953246609 1 Left 953246603 3:41199403-41199425 CCCCTTGTCCTCGCGCGGCGGAA 0: 1
1: 0
2: 1
3: 0
4: 16
Right 953246609 3:41199427-41199449 GCTCCGCGCTGCGCCGGTGGCGG 0: 1
1: 0
2: 0
3: 15
4: 118
953246606_953246609 -7 Left 953246606 3:41199411-41199433 CCTCGCGCGGCGGAACGCTCCGC 0: 1
1: 0
2: 1
3: 3
4: 35
Right 953246609 3:41199427-41199449 GCTCCGCGCTGCGCCGGTGGCGG 0: 1
1: 0
2: 0
3: 15
4: 118
953246595_953246609 15 Left 953246595 3:41199389-41199411 CCCCTCGCGCCCCGCCCCTTGTC 0: 1
1: 0
2: 1
3: 49
4: 337
Right 953246609 3:41199427-41199449 GCTCCGCGCTGCGCCGGTGGCGG 0: 1
1: 0
2: 0
3: 15
4: 118
953246597_953246609 13 Left 953246597 3:41199391-41199413 CCTCGCGCCCCGCCCCTTGTCCT 0: 1
1: 0
2: 3
3: 44
4: 374
Right 953246609 3:41199427-41199449 GCTCCGCGCTGCGCCGGTGGCGG 0: 1
1: 0
2: 0
3: 15
4: 118
953246605_953246609 -1 Left 953246605 3:41199405-41199427 CCTTGTCCTCGCGCGGCGGAACG 0: 1
1: 0
2: 0
3: 2
4: 23
Right 953246609 3:41199427-41199449 GCTCCGCGCTGCGCCGGTGGCGG 0: 1
1: 0
2: 0
3: 15
4: 118
953246604_953246609 0 Left 953246604 3:41199404-41199426 CCCTTGTCCTCGCGCGGCGGAAC 0: 1
1: 0
2: 0
3: 2
4: 21
Right 953246609 3:41199427-41199449 GCTCCGCGCTGCGCCGGTGGCGG 0: 1
1: 0
2: 0
3: 15
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953246609 Original CRISPR GCTCCGCGCTGCGCCGGTGG CGG Exonic