ID: 953250474

View in Genome Browser
Species Human (GRCh38)
Location 3:41242108-41242130
Sequence TTTTTTTAATTGATGATCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1016
Summary {0: 1, 1: 0, 2: 19, 3: 44, 4: 952}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953250474_953250478 13 Left 953250474 3:41242108-41242130 CCATTGATCATCAATTAAAAAAA 0: 1
1: 0
2: 19
3: 44
4: 952
Right 953250478 3:41242144-41242166 TTAAGGAAAATATCCACAGATGG 0: 1
1: 0
2: 2
3: 35
4: 364
953250474_953250477 -4 Left 953250474 3:41242108-41242130 CCATTGATCATCAATTAAAAAAA 0: 1
1: 0
2: 19
3: 44
4: 952
Right 953250477 3:41242127-41242149 AAAAGGGACAAGCTATTTTAAGG 0: 1
1: 0
2: 1
3: 22
4: 246
953250474_953250479 20 Left 953250474 3:41242108-41242130 CCATTGATCATCAATTAAAAAAA 0: 1
1: 0
2: 19
3: 44
4: 952
Right 953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG 0: 1
1: 0
2: 1
3: 17
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953250474 Original CRISPR TTTTTTTAATTGATGATCAA TGG (reversed) Intronic
900075546 1:813700-813722 TTTTTAAAATTGCTAATCAAGGG + Intergenic
901030434 1:6304406-6304428 TTTTTTTAATTGATAATTCTTGG + Intronic
901223819 1:7600498-7600520 TTTTTTTAATTGATCATTCTTGG + Intronic
901386496 1:8912755-8912777 TTTTTTTAATTGATCATTCTTGG - Intergenic
901562411 1:10083038-10083060 TTTTTTTAATCTATCATCGATGG + Intronic
901734670 1:11305084-11305106 TTTTTTTAATTGATCATTCTTGG + Intergenic
901849720 1:12007778-12007800 TTTTTTTAATTGATCATTCTTGG + Intronic
902027382 1:13394289-13394311 TTTTTTTAATTGATCATTCTTGG + Intergenic
903081928 1:20817225-20817247 TTTTTTTAATTGATCATTCTTGG - Intronic
903145836 1:21371579-21371601 TTTTTTTAATTTAAGTTCTAGGG - Intergenic
903426635 1:23258391-23258413 TTTTTTTAATTGATCATTCTTGG - Intergenic
903458536 1:23504952-23504974 TTTTTTTAATTGATCATTCTTGG - Intergenic
903531487 1:24033854-24033876 TTCTTTTAATTTCTGTTCAAGGG + Intergenic
904220398 1:28962986-28963008 TTCTTTTAATGGATGACCATGGG + Intronic
905520981 1:38599442-38599464 TTTTTTTAAGGGAAGATCAGTGG - Intergenic
906120094 1:43383907-43383929 TTATTTAAATTGATGTTCACTGG - Exonic
906353396 1:45082309-45082331 TTTTTTTAATTGATCATTCTTGG - Intronic
906429012 1:45739835-45739857 TTTTTTTAATTGATCATTCTTGG + Intronic
908306751 1:62826604-62826626 TTTTTTTAATTTAAGTTCTAGGG + Intronic
908606268 1:65800122-65800144 TTTTTTTAATCCATGATATAAGG - Intronic
908696376 1:66846838-66846860 ATTTTTTAATACATGATTAAAGG + Intronic
908834074 1:68210851-68210873 TGTTCTGAATAGATGATCAAGGG + Intronic
910412539 1:86963171-86963193 TTTTTTTAATTGATCATTCTTGG + Intronic
910413772 1:86974914-86974936 TCTTTTAAATTGATTATCTATGG + Intronic
910532202 1:88250406-88250428 TTTATTTAATTGAGGAGGAAAGG + Intergenic
910988817 1:93033544-93033566 ATTTTGTAAGTGATGTTCAATGG + Intergenic
911049973 1:93662567-93662589 TTTTTTTAACTGATGAAAACAGG + Intronic
911296989 1:96129666-96129688 TAATTTTAATTAATGATCACAGG + Intergenic
911378466 1:97081284-97081306 TCTTTTTAAGAAATGATCAATGG - Intronic
911454043 1:98100834-98100856 TATTTTTAATGGAATATCAAAGG - Intergenic
911486373 1:98511794-98511816 TTTTTTTAATTGATCATTCTTGG + Intergenic
911564430 1:99446417-99446439 TTTTTCTACTTGAAGACCAAAGG - Intergenic
911598732 1:99824394-99824416 TTTTTTTAATTGATCATTCTTGG - Intergenic
911961721 1:104312455-104312477 TTTTTTTATTTGATGATTTCTGG + Intergenic
912012220 1:104981390-104981412 TTTTTTTAATTCATGTGAAAAGG + Intergenic
912266028 1:108159477-108159499 TTTTTTTAATTGATCATTCTTGG + Intronic
912302825 1:108535488-108535510 TTTTTTTAATTGATCATTCTTGG + Intergenic
912307122 1:108579666-108579688 TTTTTTTAATTGAAGATTTGTGG + Intronic
912371335 1:109176617-109176639 TTTTTTTAATTGATCATTCTTGG + Intronic
912660854 1:111529380-111529402 TTTTTTTAATTGATCATTCTTGG + Intronic
913022638 1:114803839-114803861 TTTTTTTAATTGATCATTCTTGG + Intergenic
913048427 1:115093514-115093536 ATTTTTTAATCGATGATAATAGG - Intergenic
914231181 1:145766010-145766032 TTTTTTTAATTGATCATTCTTGG + Intronic
914467881 1:147948772-147948794 TTTTTTTAATTGATCATTCTTGG + Intronic
914987207 1:152471416-152471438 TTTTTTTAATTGATCATTCTTGG + Intergenic
915190869 1:154149408-154149430 TTTTTTTTCTTTATGGTCAATGG - Intronic
915427029 1:155835448-155835470 TTTTTTTAATTGATCATTCTTGG - Intronic
915690619 1:157685888-157685910 TTTTTTTAATTAATGAAAAAGGG + Intronic
916105162 1:161424282-161424304 TTTTTTTAATTGATCATTCTTGG - Intergenic
916131517 1:161615968-161615990 TTTTTTTAATTGATCATTCTTGG + Intronic
916462663 1:165042866-165042888 TTTTTTTAATTGGTATTTAAAGG + Intergenic
916755996 1:167771013-167771035 TTTTTTTAATTGATCATTCTTGG + Intronic
916989934 1:170232055-170232077 TTTTTTTAATTCATGTTGAAAGG + Intergenic
917126458 1:171693151-171693173 TTTTTTTAATTGATCATTCTTGG + Intergenic
917392345 1:174552173-174552195 ATTTTTTAATTTAAGTTCAAGGG + Intronic
917555277 1:176079622-176079644 TTTTTTTAATTATAGATTAAAGG - Intronic
917664838 1:177215368-177215390 TTCTTTTAATTCATGAACATGGG + Intronic
917996957 1:180449891-180449913 TTTTTTTAATTTAAGTTCTAGGG - Intronic
918022584 1:180710213-180710235 TTTTTTTAATTGATCATTCTTGG + Intronic
918566933 1:185945062-185945084 TATTTTTAATATATGATGAAGGG + Intronic
918643064 1:186867592-186867614 TTTTTTTAATTGATTATATTGGG + Intronic
918870046 1:189959702-189959724 TTTTTTAAATTGTTGAACAGAGG - Intergenic
919053906 1:192544861-192544883 TTTTGTCAATTGATGAAAAAAGG + Intergenic
919080376 1:192858367-192858389 TTTTTTTAATTGATCATTCTTGG - Intergenic
919346062 1:196380051-196380073 TGTTTTTAATTGAATAACAATGG - Intronic
919925682 1:202190834-202190856 TTTTTTTAATTGATCATTCTTGG + Intergenic
919994159 1:202732393-202732415 TTATATTAATTCATGGTCAAAGG - Intronic
920451826 1:206065259-206065281 TTTTTTTAATTGATCATTCTTGG - Intronic
921393890 1:214647958-214647980 TTGTATTAGTTGATGATTAAAGG + Intronic
921406487 1:214785283-214785305 TTTTTTTAATTTAAGTTCTAGGG - Intergenic
921902495 1:220465695-220465717 TTTTTTTAATTGATCATTCCTGG + Intergenic
922201639 1:223407584-223407606 TTTTTTTTAGTGATTGTCAATGG - Intergenic
922204363 1:223433639-223433661 TTTTTTTAATAGAGGAATAAGGG + Intergenic
922271389 1:224038574-224038596 TTTTTAAAATTGCTAATCAAGGG + Intergenic
922278679 1:224101700-224101722 TTTTTTTAATTGATCATTCTTGG - Intergenic
922372625 1:224926577-224926599 ATTTTTTAATTCATGGTAAAAGG - Intronic
922403992 1:225292713-225292735 TTTTTTTGATTCATGAACATGGG + Intronic
923268274 1:232333070-232333092 TTTTTTTAATTGATCATTCTTGG - Intergenic
923284793 1:232483257-232483279 TTTTTTTAATTTTAGATCCAGGG + Intronic
924241094 1:242041353-242041375 TTTTTTTAATTTAGGAAAAAGGG + Intergenic
924323739 1:242874875-242874897 TTTTTTTATATCATGTTCAAGGG - Intergenic
1062998091 10:1887331-1887353 ATCTTTTAATTTATGATTAAAGG - Intergenic
1063106463 10:2996816-2996838 TTTTTATATTTGATGAAAAAGGG + Intergenic
1063190946 10:3694198-3694220 TTTTTTTAAATGTAGATTAATGG + Intergenic
1063275800 10:4566332-4566354 TTTTTTTAGTTTATGATCTAGGG + Intergenic
1063459437 10:6205983-6206005 TTTTTTTAATTGATCATTCTTGG + Intronic
1063820025 10:9823813-9823835 TTGTAGTAATTGATGATAAAAGG - Intergenic
1063852166 10:10205215-10205237 TGTTTAGAATTGATGATAAATGG + Intergenic
1064473376 10:15660289-15660311 TTTTAATAATTTATGAACAAGGG + Intronic
1064608857 10:17075848-17075870 TTTTTTTATTAGATGCTGAAGGG - Intronic
1064623634 10:17240321-17240343 TTTTTTTAATTGAGATTCAGGGG - Intergenic
1065840661 10:29697779-29697801 TTTTTTTAATTGATCATTCTTGG - Intronic
1066136879 10:32456493-32456515 TTTTTTTTAATCATCATCAAGGG + Intronic
1066332257 10:34437214-34437236 TTTTTTGAGTTGATGATGATAGG - Intronic
1067034312 10:42901252-42901274 TTTTTTTAATTGATCATTCTTGG - Intergenic
1067339976 10:45392690-45392712 TTTTTTTAATTGATCATTCTTGG - Intronic
1067354739 10:45513207-45513229 TTTTTTTAATTGATCATTCTTGG - Intronic
1068005779 10:51392143-51392165 TTTTTTTAATTGATCATTCTTGG + Intronic
1068064092 10:52106795-52106817 TTTTTTGAATTGAAAATAAATGG - Intronic
1068405932 10:56588828-56588850 TTTTTTGAAAAGATGACCAAAGG - Intergenic
1068476596 10:57534876-57534898 TTCTTATAATTGCTGATCTAAGG - Intergenic
1068540435 10:58287621-58287643 TCTTTTTTCTTGATGATCAGAGG - Exonic
1068878556 10:62024110-62024132 TTTGTTGAATTGATGAACGATGG - Intronic
1068927568 10:62556075-62556097 TTTTTCCAATTTATCATCAATGG + Intronic
1069406785 10:68109250-68109272 TTTTTTTGAATGATGAACTATGG + Exonic
1069473939 10:68716870-68716892 TTTTTATTAAAGATGATCAAAGG + Intergenic
1069733147 10:70631975-70631997 TTTTTTTAATTGATCATTCTTGG - Intergenic
1070052155 10:72899813-72899835 TTTTTTTAAGTGATATACAATGG + Intronic
1070135654 10:73690591-73690613 TTTTTTTAATTGATCATTCTTGG - Intronic
1071083944 10:81846155-81846177 TTTTTGTAATTGATGCTGTATGG + Intergenic
1071162843 10:82771018-82771040 CTTTTTGAATTAATGATCCAAGG + Intronic
1071282497 10:84115297-84115319 TTTTTTCCAGTGAGGATCAAGGG - Intergenic
1072013186 10:91322520-91322542 TTTTTTTAATTGATCATTCTTGG + Intergenic
1072198052 10:93133845-93133867 TTTTTTTAAACGATGAACATGGG - Intergenic
1072461258 10:95620919-95620941 TTTTTTTAATTTAAGTTCTAGGG - Intronic
1072730491 10:97842431-97842453 TTTTTTTAATTGATCATTCTTGG - Intergenic
1072772604 10:98153594-98153616 TTTTTTTAATTGATCATTCTTGG - Intronic
1073564357 10:104522458-104522480 TTTTTTTAAATGATGATTCTGGG + Intergenic
1074335663 10:112572247-112572269 TCATTTTATTTGATGATGAAGGG - Intronic
1074812147 10:117115272-117115294 TTTTTCTAAGTGAGGCTCAAAGG - Intronic
1075013953 10:118896394-118896416 TTTTTTTAATTGATCATTCTTGG - Intergenic
1075268790 10:121030690-121030712 TTTTTATAGTTAATAATCAAAGG + Intergenic
1075407119 10:122202671-122202693 TTTTTTTAATTGATCATTCTTGG + Intronic
1075474469 10:122721790-122721812 TTTTTTTTATTGTTGCTGAATGG + Intergenic
1075618544 10:123908931-123908953 TTTTTTTAATTGAAGATATAAGG - Intronic
1075914439 10:126155411-126155433 TTTTTTTAACAGATAATCCAAGG + Intronic
1076027508 10:127128340-127128362 TTTTTTTTTTTGAGGTTCAAGGG + Intronic
1076617892 10:131768836-131768858 GAGTTTTCATTGATGATCAAGGG - Intergenic
1077627305 11:3783869-3783891 TTTTTTTAATTGATCATTCTTGG - Intronic
1077771995 11:5229302-5229324 CTTTTTTAAATGATGAACTATGG + Intronic
1078500061 11:11864152-11864174 TTTTTTTAACTGTTTATTAAAGG - Intronic
1079570236 11:21934131-21934153 TTTTATTGACTCATGATCAAGGG + Intergenic
1079963889 11:26956918-26956940 TTTTCTTAATTGAAGTTCAAAGG - Intergenic
1080334256 11:31177961-31177983 TTTTTTGTCTAGATGATCAATGG - Intronic
1080527057 11:33133352-33133374 TTTTTTCTATTAATTATCAAAGG + Intronic
1080919192 11:36691907-36691929 ATTTTTAAAATGAGGATCAAAGG + Intergenic
1080944992 11:36961795-36961817 TTTTTCTAATTGATAAACATGGG - Intergenic
1081274863 11:41136046-41136068 TTTTTTGAATAAATGATGAATGG - Intronic
1081499205 11:43649118-43649140 TTTTTTTAATTATTAACCAAAGG + Intronic
1081514840 11:43817629-43817651 TTTGTTTTATTGAAGATCAGTGG + Intronic
1081865877 11:46360477-46360499 TTTTTTTTTTTGATGAGGAAAGG - Intronic
1081950020 11:47037398-47037420 TTTTTTTAATTGATCATTCTTGG + Intronic
1081954045 11:47074027-47074049 TTTTTTTAATAGAAGAAGAAAGG - Intronic
1082210328 11:49493184-49493206 TTATTTTAATTCATGAACATAGG - Intergenic
1083042436 11:59700527-59700549 TTTTTTTAATTGATTATTCTTGG - Intergenic
1083469017 11:62869569-62869591 TTTTTTTTCTTGATGATTATTGG + Intronic
1084186827 11:67477443-67477465 TTTTTTTAATTGATCATTCTTGG + Intergenic
1084469651 11:69350389-69350411 TTCTTTTAATTGCTGAGAAAGGG + Intronic
1084745370 11:71166800-71166822 TTTTTTTAATTGATCATTCTTGG + Intronic
1085097970 11:73775906-73775928 TTTTTTTAATTGATCATTCTTGG - Intergenic
1085116331 11:73935618-73935640 TTTTTTTAATTGATCATTCTTGG + Intergenic
1085448938 11:76619824-76619846 TTTTTTTAATTGATCATTCTTGG - Intergenic
1085468730 11:76742851-76742873 TTTTTTAAATAGATGAGCAAAGG + Intergenic
1085574079 11:77587304-77587326 TTTTTTAAATTAAAGAACAAGGG - Intronic
1085667039 11:78423104-78423126 TTTTTTTAATTTAAGTTCCAGGG - Intergenic
1086188863 11:84054072-84054094 TTTTATTAATTGATATCCAAAGG - Intronic
1086421659 11:86643563-86643585 TTTATATAATTTAAGATCAAAGG + Intronic
1086568761 11:88258747-88258769 TTCTTTTTATTGATGAGCATGGG + Intergenic
1087396432 11:97606333-97606355 TTTTTTTAAACAAAGATCAAAGG - Intergenic
1087453967 11:98359746-98359768 TTTTTTTATTAGCTGATGAACGG - Intergenic
1087556478 11:99728027-99728049 TTTTATTCATTCAAGATCAATGG + Intronic
1087730712 11:101775514-101775536 GATTTTTAAATGACGATCAATGG - Intronic
1087810075 11:102600918-102600940 TTTTTTTAAGTGATCAACAGTGG - Intronic
1088257350 11:107913457-107913479 TTTTTTTAATTGATCATTCTTGG - Intronic
1088420527 11:109640433-109640455 TTTTTTTAAAAAATGATCTATGG + Intergenic
1088980309 11:114857114-114857136 TTTATTTGACCGATGATCAATGG + Intergenic
1090060337 11:123459212-123459234 TTTTTTAATTTGCTGATCATGGG + Intergenic
1092102428 12:5896317-5896339 TTTTATTAGTTGTTGATCTAGGG - Intronic
1092378019 12:7971650-7971672 TTTTTTTAATTGTTTTTAAAGGG - Intergenic
1092402118 12:8185334-8185356 TTTTTTTAATTGATCATTCTTGG - Intronic
1092620883 12:10266438-10266460 TTTTTTTAAAAGATGAGCCAAGG - Intergenic
1092897365 12:13025590-13025612 TTTTTTTAATGGAAGAATAACGG - Intergenic
1093524921 12:20094523-20094545 TTTTAATAATTTTTGATCAAGGG - Intergenic
1093927952 12:24926940-24926962 TTTTTTTAATTGATCATTCTTGG - Intronic
1094095172 12:26695708-26695730 TTAATTGAATTGAAGATCAATGG - Intronic
1094144189 12:27211730-27211752 TTTTTTTAATCAATAAGCAATGG - Intergenic
1094153410 12:27311805-27311827 TATTTTTAATTGTTAAACAAAGG - Intronic
1094435509 12:30416677-30416699 TTTTTGTCATTGTTGATGAATGG - Intergenic
1095280952 12:40352473-40352495 TTTTTTTAATTGATCATTCTTGG + Intronic
1095781264 12:46063123-46063145 TTTTTTTAATTGCTAAACTAAGG - Intergenic
1096039173 12:48499738-48499760 TTTTTTTAATTGATCATTCTTGG + Intergenic
1096041256 12:48519819-48519841 TTTTTTTAATTGATCATTCTTGG + Intronic
1096082722 12:48843280-48843302 TTTTTTTAATTGATCATTCTTGG - Intronic
1096167124 12:49435658-49435680 TTTTTTTAATTGATCATTCTTGG + Intronic
1096225233 12:49861966-49861988 TTTTTTTAATTGATCATTCTTGG - Intergenic
1096441359 12:51645935-51645957 TTTTTTTAATTGATCATTCTTGG - Intronic
1096708479 12:53438271-53438293 TTTTTTTAATTGATCATTCTTGG - Intergenic
1096723614 12:53543354-53543376 TTTCTTGAATTCATGTTCAAAGG + Exonic
1096766820 12:53897923-53897945 TTTTTTTAATTTAAGTTCTAGGG + Intergenic
1097279513 12:57836005-57836027 TTGTTTTAATTAATTATCCAAGG + Intronic
1097363776 12:58688150-58688172 ATTTTTAAATTGATGACAAAAGG + Intronic
1097369165 12:58755299-58755321 TTTTTCTCATCGTTGATCAATGG - Intronic
1097473987 12:60031525-60031547 TTCTTTTAACAGATGATAAAGGG - Intergenic
1097749295 12:63334295-63334317 TTTTTTGCATTGATATTCAACGG - Intergenic
1097755572 12:63403452-63403474 CTTATTTAAGGGATGATCAAGGG - Intergenic
1098004722 12:65983880-65983902 CTATTTTAATGGATGATTAAGGG + Intergenic
1098036269 12:66305426-66305448 TTTTTTTTATTAATGATTCAAGG - Intronic
1098370762 12:69758997-69759019 TTTTTTTAATTGATCATTCTTGG + Intronic
1098583220 12:72126329-72126351 TTTTTTTAATTTGTGAAGAATGG - Intronic
1099214378 12:79836429-79836451 TTTTTTAACTTGAAGTTCAAAGG - Intronic
1099622025 12:85014912-85014934 TTTTTTTTATAGATAATGAAAGG + Intronic
1100069940 12:90702609-90702631 TTTTTTTAGTTAATGATTAGTGG - Intergenic
1100254482 12:92869157-92869179 TTTTTCTAAATGATGTCCAAGGG + Intronic
1100720046 12:97348304-97348326 TTTCTTTAAATGATGACGAAAGG + Intergenic
1100728236 12:97433444-97433466 TTCTTTTAATTAATAATCACTGG - Intergenic
1100736430 12:97539194-97539216 TGCTTTTAAGTGATAATCAAAGG - Intergenic
1100759191 12:97788027-97788049 TATTTTTAATTTAAGATCTAAGG + Intergenic
1100925978 12:99548764-99548786 ATTTTTTAATGGTTCATCAAAGG - Intronic
1101072522 12:101090727-101090749 TTTTTTTAATTTAAGTTCTAGGG - Intronic
1101200496 12:102430588-102430610 TTTTTTTAAGTCATCTTCAATGG - Intronic
1101784430 12:107870774-107870796 TTTTTTTAACAGAGAATCAAAGG - Intergenic
1101932011 12:109022360-109022382 TTTCTTTAATTGTTGACAAAGGG + Intergenic
1102268456 12:111508141-111508163 TTTTTTTAATTGATCATTCTTGG - Intronic
1102993309 12:117330173-117330195 TAATTTTAAGTGAAGATCAAGGG + Intronic
1103461091 12:121105871-121105893 TTTTTTTAATTGAAAAGCACAGG - Intergenic
1103814565 12:123643646-123643668 TTTTTTAAATTAATGATTTATGG + Intronic
1103877724 12:124141553-124141575 TTTCTTAAAATGATGATAAATGG + Intronic
1104166749 12:126238918-126238940 TTTTTTTAATTTATAAAGAAAGG - Intergenic
1104201583 12:126595184-126595206 CTTTTTGATTTGATGAACAAAGG - Intergenic
1105207986 13:18239080-18239102 TTTTCTTCATTGATGATCAATGG - Intergenic
1105808250 13:23971932-23971954 TTTTTTTAATTGATCATTCTTGG + Intergenic
1106104987 13:26724799-26724821 TTTTTTTAATTGATCATTCTTGG - Intergenic
1106821331 13:33467841-33467863 TTGTTTGAATTGCTGTTCAAGGG + Intergenic
1106970197 13:35130632-35130654 TTTTTGTAATTGATCTTCTAAGG - Intronic
1107542245 13:41401842-41401864 TTTTTTTTAAGGATGATGAATGG - Intergenic
1107822084 13:44295353-44295375 TATTTTTATTTGATTCTCAAGGG + Intergenic
1107919448 13:45188915-45188937 TTTTTTTAATTTAAGTTCTAGGG + Intronic
1108024544 13:46163618-46163640 TTTTTTTAATTGATCATTCTTGG - Intronic
1108307124 13:49148818-49148840 TTTTTTGAATACATGAGCAATGG + Intronic
1108377561 13:49827720-49827742 TGGTTTTAACTGATGATCAGGGG - Intergenic
1108502222 13:51078890-51078912 TTTTTTTAATTGATCATTCTTGG - Intergenic
1108559584 13:51628815-51628837 ATTTTTTAAATGCTGGTCAATGG - Intronic
1108610716 13:52080874-52080896 TTTTTTTAATTGATCATTCTTGG - Intronic
1109241902 13:59899812-59899834 TCTTTTTAATTGATGGCAAAAGG - Intronic
1109257010 13:60096080-60096102 TTTTCTTAATTTATGAACATAGG + Intronic
1109632809 13:65074902-65074924 TTTTTTTAATTGTCGGTAAATGG - Intergenic
1109647555 13:65278780-65278802 TTTTGTCATTTAATGATCAATGG - Intergenic
1109707753 13:66120444-66120466 TAATTTTAATTGATGATGATAGG - Intergenic
1110188644 13:72704281-72704303 TTTTTTTAATTAAAGTTCTAGGG + Intergenic
1110194004 13:72765032-72765054 CTTTTCTAATAGATGACCAAGGG - Intronic
1110309269 13:74028858-74028880 TCTTTTTAATTGATCATATAAGG - Intronic
1110898183 13:80783903-80783925 CTTTTGTGATTGATGATCAGTGG - Intergenic
1110954061 13:81530960-81530982 TGTTTTTAAATGATGATGCAAGG - Intergenic
1111021230 13:82454932-82454954 TTTTTTTAATCCATGAACATCGG - Intergenic
1111439540 13:88261852-88261874 TTTTTTAACTTAATGATAAAAGG - Intergenic
1112172023 13:96983695-96983717 TTTTTTCAAATCAGGATCAAAGG - Intergenic
1114199604 14:20507596-20507618 TTTTTTTAATTGATCATTCTTGG - Intronic
1114508155 14:23233389-23233411 TTTTTTTAATTGATCATTCTTGG - Intronic
1114789256 14:25637795-25637817 ATATTTTAAATGATGATAAAGGG - Intergenic
1114808069 14:25861028-25861050 TTTTTTTCCTTTAAGATCAAGGG + Intergenic
1115505426 14:34089315-34089337 TTTTTTTTAGTGATTATAAATGG - Intronic
1115808417 14:37078555-37078577 TTTTTTTAACTGCTTATTAAGGG - Intronic
1115847344 14:37554663-37554685 TTTTTTTAATTGATCATTCTTGG + Intergenic
1116739133 14:48733244-48733266 TTTTTTTTTTTCATCATCAATGG - Intergenic
1116928385 14:50665647-50665669 TTTTGTTACTTAATGATGAAAGG - Intronic
1118238754 14:64037143-64037165 TTTTTTTAATTGATCATTCTTGG + Intronic
1118423716 14:65634546-65634568 TTTTTTTAATTGATCATTCTTGG - Intronic
1118890435 14:69903885-69903907 TTTTTTTAATTGATCATTCTTGG - Intronic
1119146811 14:72324368-72324390 TTTTTTTAATTTAAGTTCTAGGG + Intronic
1119157011 14:72420816-72420838 TCTTTTAAATTAATAATCAATGG - Intronic
1119825547 14:77654482-77654504 TTTGTTTGATTGATGGACAAAGG + Intergenic
1120392513 14:83926298-83926320 TTTTTTTAAAAAATGAGCAAGGG + Intergenic
1122212539 14:100181912-100181934 TTTTTTTAATTGATCATTCTTGG - Intergenic
1202848237 14_GL000009v2_random:200789-200811 TTTTTTTAATTGATCATTCTTGG - Intergenic
1123782776 15:23644506-23644528 TTCTTTCAATTGATAACCAAAGG + Exonic
1125351430 15:38771270-38771292 TCTTTTTTATAGATGATCTATGG - Intergenic
1125773934 15:42193841-42193863 TTTTTTTTTTTTATGAACAAAGG - Intronic
1125824110 15:42660958-42660980 TTTTTTGAAGTGATGATCCAGGG + Intronic
1125868730 15:43077631-43077653 TTTTTTTAATTGATCATTCTTGG - Intronic
1126051603 15:44690662-44690684 TTTTTTTAAATGACTTTCAAAGG - Intronic
1127112493 15:55689617-55689639 TTTTTTTAATTTAAGTTCTAGGG - Intronic
1127150151 15:56066146-56066168 TTTTTTTAATTTAAGTTCTAGGG + Intergenic
1127385599 15:58464110-58464132 TTTTTTAAAATCATGATAAAAGG + Intronic
1127452003 15:59125558-59125580 TTTTTTTAATTGAAGTTCTGGGG + Intergenic
1128079000 15:64845227-64845249 TTTTTTTAATGAGTGATCCAAGG + Intronic
1128182078 15:65612902-65612924 TATATTAAATTGATGATAAAAGG + Intronic
1128489498 15:68133746-68133768 TTTTTTTAATTGATCATTCTTGG + Intronic
1130294656 15:82636969-82636991 GTTTTTTTATTGATGAAGAATGG - Intronic
1130319650 15:82830420-82830442 TTTTTTTAATCCATGAAAAATGG + Intronic
1130428052 15:83821254-83821276 TTTTTTTAATTGATCATTCTTGG + Intronic
1130946027 15:88551735-88551757 TTTTTTTAATTGATAATTCTTGG + Intergenic
1131348811 15:91677377-91677399 TTTTTTTAATTGAAGGTCCCTGG - Intergenic
1131473899 15:92719746-92719768 TTGATGTATTTGATGATCAATGG - Intronic
1132040807 15:98523315-98523337 TTATTTTAATTGGTGATGGAGGG - Intergenic
1133144799 16:3776699-3776721 TTTTTTTAATGGATGGTGAAGGG - Intronic
1133680561 16:8115903-8115925 TTTTTTTAATTGATCATTCTTGG - Intergenic
1133787201 16:8982700-8982722 TTTTTTTAATTGATCATTCTTGG - Intergenic
1134376746 16:13683011-13683033 TATTTTTAGTTGCTGATCATGGG - Intergenic
1135575751 16:23584240-23584262 TTTTTTTAATTGATCATTCTTGG - Intronic
1135694172 16:24573501-24573523 TTTTTTTAATTGATGATTCTTGG + Intergenic
1136237033 16:28920868-28920890 TTTTTTTAATTTTTGAGAAAGGG + Intronic
1136652761 16:31687201-31687223 TTTTTTTAATTGAAAAGAAAAGG + Intergenic
1137304156 16:47182164-47182186 TTTTTTTAATTGATCATTCTTGG - Intronic
1137390674 16:48078901-48078923 TTTTTTTAATTGTAGATTCAGGG - Intergenic
1137681440 16:50349375-50349397 TTTTTTTAATTTAAGTTCTAGGG - Intronic
1138028447 16:53540232-53540254 TTTTTTTAATTGATCATTCTTGG - Intergenic
1138464479 16:57178041-57178063 TTTCTTTATTTGGGGATCAAGGG - Intronic
1138642010 16:58395341-58395363 TTTTTTTAATTGATCATTCTTGG + Intronic
1138871945 16:60900951-60900973 TATTTTTAATTAATGCTCCATGG + Intergenic
1139623006 16:68162756-68162778 TTTTTTTAATTGATCATTCTTGG + Intronic
1139864832 16:70052931-70052953 TTTTTTTAATTGATCATTCTTGG - Intergenic
1139887872 16:70224200-70224222 TTTTTTTAATTGATCATTCTTGG + Intergenic
1140297778 16:73725964-73725986 TTTATTTAATGGATGGTGAAAGG - Intergenic
1140313979 16:73875817-73875839 GTTTTGTCATTGATGATTAATGG - Intergenic
1141245464 16:82302848-82302870 TTTTTTTATTTTAACATCAATGG - Intergenic
1141288003 16:82690701-82690723 TTTCTTTTATTCATGAACAACGG - Intronic
1141404666 16:83781914-83781936 TTTTTTTAATTGAAGTTCCGGGG - Intronic
1141835507 16:86536436-86536458 TTTTGTTCATAGTTGATCAAAGG + Intronic
1142391834 16:89806361-89806383 TTTTTTTAATTGATCATTCTTGG + Intronic
1142634125 17:1246535-1246557 TTTTTTTAATTGATCATTCTTGG + Intergenic
1143035840 17:3997380-3997402 TTTTTTTAATTGATCATTCTTGG + Intergenic
1143035952 17:3998438-3998460 TTTTCTTAGTTGTTGATCTAGGG + Intergenic
1143424182 17:6820297-6820319 CTTTTTTAAATGATAATTAAAGG + Intronic
1143666917 17:8367916-8367938 TTTTTTTAATTGATCATTCTTGG - Intergenic
1143774660 17:9190431-9190453 TTTTTTTAAAAGAAGATTAATGG + Intronic
1144346868 17:14357285-14357307 TTTTTCTCATTAATGATCCATGG + Intergenic
1144510212 17:15868354-15868376 TTTTTTTAATTGATCATTCTTGG - Intergenic
1144860614 17:18299036-18299058 TTTTTTTAATTGATCATTCTTGG - Intronic
1145022462 17:19442391-19442413 TTTTTTTAATTGATCATTCTTGG - Intergenic
1145109252 17:20147370-20147392 TTTTTTTAAATCATGATCCATGG - Intronic
1145174371 17:20686072-20686094 TTTTTTTAATTGATCATTCTTGG - Intergenic
1145884980 17:28375624-28375646 TTTTTTGAATTTATGTGCAATGG - Intronic
1146156044 17:30524199-30524221 TTTTTTTAATTGATCATTCTTGG - Exonic
1146157558 17:30536427-30536449 TTTTTTTAATTGATCATTCTTGG + Intergenic
1146362310 17:32186959-32186981 TTTTTTTAAATTATTATTAAAGG + Intronic
1146514901 17:33481503-33481525 TCTTGTGAATGGATGATCAATGG - Intronic
1146862910 17:36320762-36320784 TTTTTTTAATTAAAGTTCTAGGG + Intronic
1147093239 17:38124845-38124867 TTTTTTTAATTAAAGTTCTAGGG + Intergenic
1147103968 17:38195643-38195665 TTTTTTTAATTAAAGTTCTAGGG - Intergenic
1147285415 17:39398972-39398994 TTTTTTTAATTTAAAACCAAGGG - Intronic
1147506726 17:41025528-41025550 TTTCTTTTATTGAGGATCATTGG - Intergenic
1147680740 17:42243108-42243130 TTTTTTTAATTGATCATTCTTGG - Intronic
1147809771 17:43159825-43159847 TTTTTTTAATTGATCATTCTTGG - Intergenic
1148016569 17:44525727-44525749 TTTTTTTAATTGATCATTCTTGG - Intergenic
1148269463 17:46252386-46252408 TTTTTTTAATTGATCATTCTTGG + Intergenic
1148425521 17:47592762-47592784 TTTTTTTAATTAAAGTTCTAGGG + Intronic
1148636207 17:49150905-49150927 TTTTTTTAATTGATCATTCTTGG - Intronic
1149633255 17:58143489-58143511 TTTTTTTAATTGATCATTCTTGG - Intergenic
1150056319 17:62020700-62020722 TTTTTTTAATTGATCATTCTTGG + Intronic
1150214231 17:63457661-63457683 TTTTTTTAATTGATCATTCTTGG - Intergenic
1150307553 17:64099514-64099536 TTTTTTTAATTGAAGACCTGGGG - Intronic
1150380735 17:64717333-64717355 TTTTTTTAATTGATCATTCTTGG - Intergenic
1151075262 17:71264734-71264756 TTTGTAGCATTGATGATCAAAGG - Intergenic
1151114751 17:71723196-71723218 TTTTATTAATTTTTGATCAGAGG + Intergenic
1151152499 17:72099871-72099893 CTTCTGTAATTTATGATCAAGGG + Intergenic
1152672870 17:81619186-81619208 TTTTTTTAATTGATCATTCTTGG - Intronic
1153682321 18:7512307-7512329 TTTATTTCTTTGATCATCAAAGG - Intergenic
1153685878 18:7544881-7544903 TTGTTTTTATTGCTGATCACTGG - Intergenic
1153847596 18:9063717-9063739 TTTTTTCAATTGCAGTTCAAGGG + Intergenic
1154440091 18:14382187-14382209 TTTTTTTAATTGATCATTCTTGG + Intergenic
1155038536 18:22045560-22045582 TTTTTTTAATTTATGATTTTCGG - Intergenic
1155293004 18:24359776-24359798 TATTTTAAATTGATTATAAAAGG + Intronic
1155455109 18:26003831-26003853 TTTTTTTAATTGAGGGGCAATGG + Intergenic
1156052131 18:32950404-32950426 ATTTCTTAACTGATGACCAATGG + Intronic
1156248319 18:35325157-35325179 TTCCTTTAAATGATGATGAAAGG - Intergenic
1156302964 18:35851531-35851553 TTTTTTTAATTGCTGCTAATGGG + Intergenic
1156616458 18:38791468-38791490 TTTTTGTAATTGTTGAGGAAAGG + Intergenic
1157465542 18:47941558-47941580 TTTTTATTATTGATTATTAATGG + Intergenic
1157656717 18:49397255-49397277 TTATTTTAATTTATCATCTATGG - Intronic
1157680298 18:49600239-49600261 TTTTCTTAATTCCTGTTCAATGG + Intergenic
1157986333 18:52442394-52442416 TTATTTTTAATCATGATCAAAGG - Intronic
1158126756 18:54108213-54108235 TTTTTTAAAATGATAATTAAAGG - Intergenic
1158484156 18:57849986-57850008 TTTTTTCCATTGATGACAAATGG - Intergenic
1158654036 18:59312636-59312658 ATTTCTTAATTAATGATAAATGG - Intronic
1158971802 18:62674984-62675006 TTTTTTTAATTTAAGTTCTAGGG + Intergenic
1159669946 18:71210955-71210977 TTTTTTGTATTGCAGATCAATGG + Intergenic
1159693345 18:71520937-71520959 TGTTTTTAATCCATTATCAAGGG + Intergenic
1159730229 18:72017021-72017043 TTTTGTTAAATGATGTTGAAGGG + Intergenic
1159859696 18:73632615-73632637 TTTTCTTAATGGTTGCTCAAGGG + Intergenic
1159995412 18:74960052-74960074 TTTGTATAATTGAAGATCAGTGG + Intronic
1160108440 18:76001892-76001914 TTTTTTTAATTGATCATTCTTGG - Intergenic
1162255340 19:9484274-9484296 TTTTTTTAATTGATCATTCTTGG - Intronic
1162279152 19:9680907-9680929 TTTTTTTAATTGATCATTCTTGG - Intergenic
1163113403 19:15175222-15175244 TTTATTTTATTGATGAGTAATGG - Intronic
1163558298 19:18005022-18005044 TTTTTTTAATTGATCATTCTTGG + Intronic
1163896297 19:20063534-20063556 TTTTTTTAATTGATCATTCTTGG + Intergenic
1163904434 19:20138591-20138613 TTTTTTTAATTGATCATTCTTGG - Intergenic
1163942938 19:20511740-20511762 TTTTTTCCAGTGAGGATCAAGGG + Intergenic
1164208360 19:23075931-23075953 TTTTTTAAATTTATGAACACAGG + Intronic
1164238810 19:23365579-23365601 TTTTTTTAATTGATCATTCTTGG + Intronic
1164256475 19:23532849-23532871 TTTTTTTAATTGATCATTCTTGG + Intronic
1164301414 19:23965105-23965127 TTTTTTTAATTGATCATTCTTGG - Intergenic
1164449601 19:28349375-28349397 TTTTATTAATTGATATTTAAAGG - Intergenic
1164492576 19:28728066-28728088 TTGTTTTTATTATTGATCAAAGG + Intergenic
1165055265 19:33172393-33172415 TTTTTGTACTTGATTACCAAAGG - Exonic
1165526788 19:36362779-36362801 TGTTTTTAAATGATCATTAAAGG - Intronic
1165541065 19:36492126-36492148 TTTTTTTAATTGATCATTCTTGG - Intergenic
1165727470 19:38123277-38123299 TTTTTTTAATTGATCATTCTTGG + Intronic
1165762936 19:38332980-38333002 TTTTTTTAAAAGATGAATAAAGG + Intergenic
1166158083 19:40930420-40930442 GTTTTTTTATTTCTGATCAATGG + Intergenic
1166166956 19:40997465-40997487 TTTTTTTAATTTCTGATCAATGG + Intronic
1166832993 19:45649192-45649214 TTTTTTTAATTGATCATTCTTGG - Intergenic
1167021938 19:46883693-46883715 TTTTTTTAACTGAAGGTCATTGG - Intergenic
1167129547 19:47574963-47574985 TTTTTTTAATTGATTATTGGGGG + Intergenic
1167541068 19:50087313-50087335 TTTTTTTAATTGATCATTCTTGG - Intergenic
1167907907 19:52677109-52677131 TTTTTTTAATTGATCATTCTTGG - Intronic
1168658600 19:58148376-58148398 TTTTTTTAATTGATCATTCTTGG - Intronic
924989385 2:298944-298966 TTTTTTTTGTTGTTGAGCAATGG - Intergenic
924992010 2:320393-320415 TTATTTTACGTGATGATAAATGG - Intergenic
925104160 2:1275309-1275331 TATTTTTAATTGAAGATTTAAGG + Intronic
925488594 2:4366782-4366804 TTTTTTTAATATATGACGAAAGG - Intergenic
926179064 2:10624186-10624208 TTTTTTTAATTGATCATTCTTGG + Intronic
926201012 2:10797794-10797816 TTTTTTGAATTGAGAATCAAAGG - Intronic
926962541 2:18374289-18374311 CTTTTTTAATTGAAGAGAAATGG - Intergenic
926965615 2:18406721-18406743 TTTTTACAATTGATCATAAATGG + Intergenic
927738122 2:25541020-25541042 TTTTTTTAATTGATCATTCTTGG - Intronic
927755749 2:25706433-25706455 TTTTTTTAATTGATCATTCTTGG - Intergenic
927905449 2:26852340-26852362 TTTTTTTATGTGAAGATGAAAGG + Intronic
928002742 2:27539120-27539142 TTTTTTTAATTGATCATTCTTGG + Intronic
928585363 2:32754156-32754178 TTTTTTTAATTGATCATTCTTGG + Intronic
928687079 2:33760876-33760898 TTTTTTTAATTGATCATTCTTGG + Intergenic
928965915 2:36975267-36975289 TTTTTCTAAATTATGATTAAGGG + Intronic
929061786 2:37932074-37932096 TTTTTTTAATTGATCATTCTTGG + Intronic
929064869 2:37963329-37963351 TTTTTTTAATTGATCATTCTTGG + Intronic
929151761 2:38755265-38755287 TTTTTTTAATTGATCATTCTTGG + Intronic
929233924 2:39586752-39586774 TTTTTTTAATTTAAAAACAAAGG - Intergenic
929298422 2:40273671-40273693 TTTAGTTAATTGCTGATTAATGG - Intronic
929517835 2:42621143-42621165 TTTTTTTAATTGATCATTCTTGG + Intronic
929613659 2:43291134-43291156 TTTTTTTAATTAGAGTTCAAAGG - Intronic
929650631 2:43677210-43677232 TTTTTTTAATTGATCATTCTTGG + Intronic
930116362 2:47721764-47721786 TTTTTTTAATTGATCATTCTTGG + Intronic
930303176 2:49643047-49643069 TTTTTTAAATTGGGCATCAAGGG - Intergenic
930457595 2:51625550-51625572 TTTTTTTACATGATGACCTATGG + Intergenic
930665212 2:54094898-54094920 TTTTTTTAATTGATCATTCTTGG + Intronic
930704115 2:54486703-54486725 TTTTTTTAATTGATCATTCTTGG - Intronic
930783417 2:55246727-55246749 TTTTTTTAAAGGATGACCACTGG + Intronic
930846803 2:55915088-55915110 TTTACTTAATTGTTGATAAAAGG - Intronic
930866641 2:56128524-56128546 TTTTTTTAAATGATGATGATTGG - Intergenic
931159278 2:59670567-59670589 TTTTTTCAAATGATCACCAAAGG - Intergenic
931320369 2:61169891-61169913 TTTTTTTAATTTATGACCAAAGG + Intergenic
931784003 2:65602857-65602879 TTATTTGAATTGGTGATCAAGGG - Intergenic
932712557 2:74078133-74078155 TTTTTTAAAATGCTGATCTAAGG - Intronic
932757705 2:74420272-74420294 TTTTTTTAAGTGATTACAAAAGG - Intronic
933735324 2:85489029-85489051 TTTTTTTAATTGATCATTCTTGG - Intergenic
934549227 2:95244324-95244346 TTTTTTTAATTGATCATTCTTGG - Intronic
934998355 2:98988192-98988214 TTTTTTTAATTGATCATTCTTGG + Intergenic
937657223 2:124390136-124390158 ATCTTTCCATTGATGATCAAAGG + Intronic
938045888 2:128119840-128119862 TTTTTTTACTTTAAGAACAAAGG + Intronic
938365916 2:130734023-130734045 TTTTTTTAATTGATCATTCTTGG - Intergenic
938828678 2:135032625-135032647 TTTTTTTAATTGATCATTCTTGG + Intronic
938963891 2:136369305-136369327 TTCTTCTAATTGATGAACATAGG - Intergenic
939075298 2:137594759-137594781 TGTTTTTACTTGATAATAAATGG + Intronic
939187053 2:138872605-138872627 TTTTTTTAATTGATCATTCTTGG - Intergenic
939365285 2:141222602-141222624 TTTTTTGCATTGATGTTCATTGG - Intronic
939394310 2:141608611-141608633 TTTTTTTAATTGTTACTCACTGG + Intronic
939433586 2:142143825-142143847 TTTTATTAATTCATGTTCTATGG - Intergenic
939477410 2:142703282-142703304 TTTTTTTAATTGATCATTCTTGG - Intergenic
939608245 2:144278551-144278573 TTTTTTTAGCTGATGAGAAATGG + Intronic
939751363 2:146051411-146051433 TTTTTTCAATTGATGAACAAAGG + Intergenic
940261910 2:151789881-151789903 TTTTTTTAATTCATGAAAAAGGG - Intronic
940439046 2:153692617-153692639 TTTTTTCTATTGATTAGCAATGG + Intergenic
940555492 2:155222088-155222110 TTTTTTCAATTTATGTGCAAAGG + Intergenic
940839406 2:158561800-158561822 TTTTTTTAATTTAAGTTCTAGGG + Intronic
940866384 2:158821619-158821641 GTTATTTTATTTATGATCAATGG - Intronic
941137708 2:161738214-161738236 TTTTGTTACTTGATGATCCTGGG + Intronic
941404589 2:165073398-165073420 TGTTTTTAATTCTTTATCAAAGG - Intergenic
941602726 2:167562660-167562682 TTTTTTTAATTGATCATTCTTGG + Intergenic
941868138 2:170355902-170355924 TTTTTTTACTAGATGATGTAAGG + Intronic
942020739 2:171865854-171865876 TTTTTTTAATTGATCATTCTTGG + Intronic
942344750 2:174990662-174990684 TTTTTTTAGTTGAAGTTAAAAGG - Intronic
942431844 2:175920424-175920446 TTTTTTTAATTTAAGTTCTAGGG - Intergenic
942910228 2:181234605-181234627 TTTTATCAACTGCTGATCAAAGG - Intergenic
942978692 2:182051503-182051525 TTTTTTTAAATGTCTATCAATGG - Intronic
942988467 2:182170291-182170313 TTTTTTGTATAGATGGTCAATGG + Intronic
943323782 2:186474178-186474200 TTTTTTTAATTGATCATTCTTGG - Intergenic
943648168 2:190430217-190430239 TTTTTTTAATTGATCATTCTTGG + Intronic
944202660 2:197124305-197124327 ATTTTTAAAGTGATGATAAAAGG + Intronic
944255545 2:197619725-197619747 TTTTTTTAATTGATCATTCTTGG - Intronic
944294936 2:198051570-198051592 TTTTTTTAAGATATGATCAGGGG - Intronic
944302403 2:198138759-198138781 TTTTTATTATTGATAATCCATGG + Intronic
944303299 2:198149915-198149937 TTTTTTTAAAAAATGTTCAATGG - Intronic
944507757 2:200430525-200430547 TTTTTTTAAATGATATTAAACGG + Intronic
944584986 2:201165593-201165615 TTTTTTTAATTGATCATTCTTGG + Exonic
944611958 2:201419719-201419741 TTGTTTTAATTTATTATCATTGG - Intronic
944749296 2:202691486-202691508 TTTTTTTAATTAAAAATCTAAGG - Intronic
944789797 2:203113448-203113470 TTGTTTTAATTGAAGCTGAAAGG + Intronic
944814996 2:203366837-203366859 ATTTTTGAATTAATGATCACTGG + Intronic
944925063 2:204456038-204456060 TTTTAATAAATGATGATAAATGG - Intergenic
945048263 2:205800582-205800604 TCTTTTTAATTGATAAAAAAGGG + Intergenic
945090172 2:206170995-206171017 TTTTTTTAATTGATCATTCTTGG + Intergenic
945153149 2:206810655-206810677 TTTTTATATTTGATGAAAAAGGG + Intergenic
945407681 2:209469503-209469525 TTTTTTTGGTTAATGATTAATGG + Intronic
945835418 2:214834308-214834330 TTTTTTTAATTGATCATTCTTGG + Intergenic
945846504 2:214951451-214951473 TTTTTTTAAAAGGTGATCATTGG - Intronic
946086363 2:217177316-217177338 TTGCTTAGATTGATGATCAATGG + Intergenic
946271856 2:218600948-218600970 TTTTTTTACTGGCTGATAAATGG - Intergenic
946471865 2:219967934-219967956 TTTTTTTAATGGATGATGATTGG + Intergenic
946530525 2:220565180-220565202 TTTTTTTAAATGATGAGCTATGG - Intergenic
946651132 2:221893015-221893037 TTTTTTTAATTGATCATTCTTGG - Intergenic
946756197 2:222950426-222950448 TTTAGCTAATTGATGATAAAAGG - Intergenic
947006191 2:225513994-225514016 TATTATTATTTGATTATCAAGGG + Intronic
947272612 2:228353473-228353495 TTATTTTTATTGATGAGCAAAGG + Intergenic
947485584 2:230545556-230545578 TTTTTTTAATTGTAAATAAATGG + Intergenic
947798219 2:232907144-232907166 TTTTTTTAATTGATCATTCTTGG - Intronic
947984369 2:234436453-234436475 TTTTTTTTATGGAGGAGCAAAGG + Intergenic
949082177 2:242111101-242111123 TTTTTAAAATTGCTAATCAAGGG - Intergenic
1168945317 20:1750029-1750051 TTTTTTTACTTTATTATCCAAGG - Intergenic
1168947568 20:1774202-1774224 TTTTTTTAATAGAAGAAGAATGG + Intergenic
1169167887 20:3440464-3440486 TTTTTTTAATTGATCATTCTTGG + Intergenic
1169286815 20:4315217-4315239 ATCTTTTAATTGGTGATGAATGG - Intergenic
1169450005 20:5702706-5702728 TTTTTTTAATTGATCATTCTTGG - Intergenic
1170019552 20:11820974-11820996 TTTTTCTCATTGCTTATCAAGGG + Intergenic
1170202718 20:13761363-13761385 TTTTTTTAATTGATCATTCTTGG - Intronic
1170384518 20:15801171-15801193 TTTTTTTAATTGATCATTCTTGG - Intronic
1171287678 20:23955215-23955237 TTTTGTTGATTGATGATCGTAGG - Intergenic
1171440671 20:25159354-25159376 TTTTGAAAATTGATGATCCATGG - Intergenic
1172471532 20:35201153-35201175 TTTTTTTAGCTGTTGATCTAGGG - Intergenic
1172741089 20:37167930-37167952 TTCTTTTAATTGGTTTTCAAGGG + Intronic
1172918252 20:38460677-38460699 TTTTTTTAATTGATCATTCTTGG + Intergenic
1173508259 20:43606598-43606620 TTTTTTTAATTGATCATTCTTGG + Intronic
1173612975 20:44384179-44384201 TTTTTTTAAATAAAGACCAAAGG + Intronic
1173815333 20:45984093-45984115 TTTTTTTAATTAAAAATTAAAGG - Intergenic
1173882358 20:46425374-46425396 TCTTTTTATTGGATGATGAATGG + Intronic
1176348070 21:5769818-5769840 TTTTTTTAATTGATCATTCTTGG + Intergenic
1176354884 21:5890402-5890424 TTTTTTTAATTGATCATTCTTGG + Intergenic
1176496757 21:7554637-7554659 TTTTTTTAATTGATCATTCTTGG - Intergenic
1176542391 21:8167888-8167910 TTTTTTTAATTGATCATTCTTGG + Intergenic
1176701759 21:10061418-10061440 TCTTTTTAATTGATGTTTCATGG + Intergenic
1176903716 21:14474795-14474817 TTGTTTTAATTGATATTCATTGG + Intergenic
1176957108 21:15118374-15118396 TATTTTTAGTTGATGCTCATGGG + Intergenic
1177308061 21:19347349-19347371 TTTTTTTAATTTTCAATCAATGG - Intergenic
1177333262 21:19688917-19688939 TTTATTTATTTGATGCTGAAGGG + Intergenic
1177519448 21:22199750-22199772 GTTTTTTAAATGATTATCATAGG + Intergenic
1177634953 21:23775292-23775314 TTTTTTGAAATGATGAACAATGG + Intergenic
1177866248 21:26516364-26516386 ATTTATTAATAGATGACCAATGG + Intronic
1178075938 21:29012755-29012777 TTTTTTTAATTGATCATTCTTGG - Intronic
1178987953 21:37324902-37324924 TTTTTTGACTTTTTGATCAAAGG - Intergenic
1180758552 22:18180969-18180991 TTTTCTTCATTGATGATCAATGG - Intergenic
1180768839 22:18364761-18364783 TTTTCTTCATTGATGATCAATGG - Intergenic
1180777473 22:18497634-18497656 TTTTCTTCATTGATGATCAATGG + Intergenic
1180810193 22:18754944-18754966 TTTTCTTCATTGATGATCAATGG + Intergenic
1180826714 22:18867985-18868007 TTTTCTTCATTGATGATCAATGG - Intergenic
1181196337 22:21189196-21189218 TTTTCTTCATTGATGATCAATGG + Intergenic
1181213190 22:21303928-21303950 TTTTCTTCATTGATGATCAATGG - Intergenic
1181433771 22:22898701-22898723 TATATTTAATTGATGATGACAGG + Intergenic
1181434712 22:22904070-22904092 TATATTTAATTGATGATGACAGG + Intergenic
1181523841 22:23466915-23466937 TTTTCTTCATTGATGATCAATGG - Intergenic
1181578610 22:23813526-23813548 TTTTATTGAGTGATGATAAATGG - Intronic
1181711104 22:24689957-24689979 TATTTTAAAATTATGATCAAAGG - Intergenic
1182152866 22:28042707-28042729 TTTTTTTAATTTAAGTTCTAGGG - Intronic
1182199560 22:28554356-28554378 TTTTTTTAATTGATCATTCTTGG - Intronic
1182394553 22:30026056-30026078 TTTTTTTGATGGAAGACCAAGGG + Exonic
1183434869 22:37787582-37787604 TTTTTTTAATTGATCATTCTTGG - Intergenic
1183941173 22:41295681-41295703 TTTTTTTAATTGATCATTCTTGG - Intergenic
1184199920 22:42961432-42961454 TTTTTTTAATTGATCATTCTTGG - Intronic
1184838455 22:47038124-47038146 TATTTGTAACTGATGATGAAAGG - Intronic
1185261535 22:49867776-49867798 TATTTTTAATTGATGATGGATGG - Intronic
1203230461 22_KI270731v1_random:105645-105667 TTTTCTTCATTGATGATCAATGG - Intergenic
1203247330 22_KI270733v1_random:84306-84328 TTTTTTTAATTGATCATTCTTGG + Intergenic
1203276857 22_KI270734v1_random:93895-93917 TTTTCTTCATTGATGATCAATGG - Intergenic
949579328 3:5371489-5371511 TTTTTTTAATTTAAGTTCTAGGG + Intergenic
949605474 3:5648039-5648061 TTTTTTTACTTATTCATCAAGGG - Intergenic
950019854 3:9779635-9779657 TTTTTTTAATTTAAGTTCTAGGG - Intronic
950049462 3:9975843-9975865 TTGTTTTAATTGATATTCCATGG + Intronic
950593510 3:13957227-13957249 TTTTTTTAATTTAAGTTCTAGGG + Intronic
951052706 3:18112258-18112280 TTTTTTTAATTTATGTTCTCTGG + Intronic
951165776 3:19483790-19483812 TTTTTTTCACTGAGGATCAAGGG + Intronic
951402179 3:22246666-22246688 TTTTTCTAATCTATGATCAAAGG + Intronic
951585197 3:24208174-24208196 TTTTTTTTTTTGTTGAGCAATGG - Intronic
951821279 3:26814859-26814881 TTTTTTTCATTGACTTTCAAAGG - Intergenic
952093806 3:29923959-29923981 TGTTTTTAATTTATTTTCAAAGG - Intronic
952376586 3:32772762-32772784 TTTTTTTAATAGCTGAAGAAGGG + Intronic
952511735 3:34065109-34065131 TTTTTATACTTGATGTTCATTGG - Intergenic
952712120 3:36442338-36442360 TTTTTGTAATTGAATATCCATGG - Intronic
953250474 3:41242108-41242130 TTTTTTTAATTGATGATCAATGG - Intronic
953268221 3:41413871-41413893 TTTTTTTATCTGAAGTTCAAAGG - Intronic
953272956 3:41463608-41463630 TTTCTTTAGTGCATGATCAAGGG + Intronic
953966127 3:47308782-47308804 TTTTTTTAATTGATCATTCTTGG + Intronic
954355818 3:50083657-50083679 TTTTTTTAATTGATCATTCTTGG + Intronic
955699620 3:61671151-61671173 TTTTTTTAATTGATCATTCTTGG + Intronic
955758720 3:62254713-62254735 TTTTTTTAATTGCTGTTCAATGG - Intronic
955825922 3:62947644-62947666 TCTTTTTAATTGCTCTTCAAGGG + Intergenic
956612481 3:71138130-71138152 TTTTTCTAATTAAGGAACAAAGG + Intronic
956839017 3:73120045-73120067 ATTTTTTAAATGATGGTCAAAGG - Intergenic
956929967 3:74032305-74032327 TTTTTTTTAGTTATTATCAAGGG - Intergenic
957538428 3:81536197-81536219 TTTTTTTAATGGCTGAACAAAGG - Intronic
957620426 3:82585674-82585696 TTTTTTTAATTGATCATTCTTGG - Intergenic
957789415 3:84919500-84919522 TTTTTTTAATTGATTATTCTTGG - Intergenic
957920539 3:86742437-86742459 TTTTTTTAGTTAATGATTAGTGG - Intergenic
958130452 3:89413361-89413383 TTTTCTGATTTCATGATCAAAGG + Intronic
958644825 3:96856230-96856252 TTTTTTTAATTTATGAGACAGGG - Intronic
958811989 3:98870900-98870922 TTCTTTTAATTCATGAACATAGG + Intronic
958912967 3:100015498-100015520 TTTTTCTAATTCATGAACACAGG + Intronic
959159274 3:102704151-102704173 TATTTCTAATTGATGACCAGAGG + Intergenic
959221803 3:103530923-103530945 TTTTTTTAATTGATCATTCTTGG + Intergenic
959237393 3:103742082-103742104 TTATTTTAATTATTGTTCAAAGG + Intergenic
959386356 3:105713380-105713402 TTTTTTTTTTTAATGATCAGTGG - Intronic
959429158 3:106231279-106231301 TATTTTTAATTTATGTTCATAGG + Intergenic
959474646 3:106794604-106794626 TTTTTTCAGTTGATGAGTAATGG - Intergenic
959501362 3:107109152-107109174 TGTTTGTAAATGATGTTCAAAGG - Intergenic
959778228 3:110196815-110196837 TTTTTTAAATTAATTATCATGGG + Intergenic
959984430 3:112557004-112557026 TTTTTTTAATTGATCATTCTTGG - Intronic
960029789 3:113045654-113045676 TTTTTTTAATTGATCATTCTTGG + Intergenic
960057876 3:113288617-113288639 TTTTTCTCCTTGATGATCTAAGG + Exonic
960133621 3:114084305-114084327 TATTTTTAATAGTTGATTAAAGG + Intronic
960579456 3:119262824-119262846 TTTTTTTTAGTGGTGCTCAAGGG - Intergenic
960817705 3:121689633-121689655 TTTTTTTAATTGATCATTCTTGG - Intronic
960921248 3:122748364-122748386 TTTTTTTAATTGATCATTCTTGG - Intronic
961227069 3:125260287-125260309 TTTTTTTAATTGAAGGTTTATGG - Intronic
961704579 3:128774063-128774085 TTTTTTTAATTGATCATTCTTGG - Intronic
962061718 3:131934862-131934884 TTTTCTTCCTTGATGATTAATGG - Intronic
962063414 3:131953224-131953246 TTTTTTTAATTGATCATTCTTGG - Intronic
962148147 3:132863181-132863203 TTTTTTTAAGTTATTATAAATGG + Intergenic
962549674 3:136476988-136477010 TTTTTCTAATTCAGAATCAAAGG - Intronic
962553199 3:136516999-136517021 TTGCTTTAATTTATGATCAGAGG - Intronic
963247228 3:143074358-143074380 TTTTTTTAATTGATCATTCTTGG - Intergenic
963406043 3:144865528-144865550 TTTTTTTAACTTATAATCATAGG - Intergenic
963597989 3:147352857-147352879 ATTTCATAAATGATGATCAAAGG + Intergenic
963896403 3:150689520-150689542 TTTTTTTAAAAGAAGCTCAATGG + Intronic
964215870 3:154281370-154281392 TTTTTTTAAATAATGATACATGG + Intronic
964865985 3:161261568-161261590 TTCTTTTAATTAATGAACATGGG + Intergenic
964905700 3:161717529-161717551 GTTTTTTAATTGAATATCCAAGG - Intergenic
965680175 3:171242144-171242166 TTTTTTTAATTTAAGTTCTAGGG - Intronic
965708504 3:171533621-171533643 TTTTTTTTTTTGCTGATTAAGGG + Intergenic
965921647 3:173923687-173923709 TTTCTTTACTTAATGATCTAAGG - Intronic
966052050 3:175630680-175630702 TTTTTTTCACTGAGGATAAATGG + Intronic
966206522 3:177412220-177412242 TTTTTTTAATTGATCATTCTTGG + Intergenic
966419912 3:179727178-179727200 TTTTTTTAATTGATCATTCTTGG + Intronic
966966829 3:185003165-185003187 TTTTTTTAATTGATCATTCTTGG + Intronic
967211082 3:187169685-187169707 TTGTTTTAAGTGATGATCCAGGG + Intronic
967370390 3:188738201-188738223 TTTTTTCAAATGATGATGATCGG + Intronic
967393650 3:188982225-188982247 TATGTTTTATTGATGATCAAAGG - Intronic
967528179 3:190518089-190518111 TTTTTTTAAATGATAATGCATGG + Intronic
968226281 3:196974310-196974332 TTTTTTTAATTGATCATTCTTGG - Intergenic
968429702 4:549854-549876 TTTTTTTAATTGATCATTCTTGG + Intergenic
968484803 4:854128-854150 TTTTTTTAATTGATCATTCTTGG + Intronic
969404347 4:6978723-6978745 TTTTTTTAATTGATCATTCTTGG - Intronic
970251779 4:14124192-14124214 TGTTTTCAATAGATGATCCATGG - Intergenic
970717731 4:18946887-18946909 TTTTTTCTATTGCTGATAAAAGG - Intergenic
971041611 4:22759165-22759187 TTTCTTTAATTGAAAATAAAAGG + Intergenic
971104454 4:23507716-23507738 TTCTTTTATTTGAAGATTAATGG - Intergenic
971712762 4:30138083-30138105 TTTTTTTATGTGTTGTTCAAAGG - Intergenic
972013210 4:34210177-34210199 TTTTTTTAATTCATTTTGAATGG - Intergenic
973109422 4:46378641-46378663 TTTTTTTAATTGATCATTCTTGG - Intronic
973778291 4:54264003-54264025 TTTTTTTAAATCATCATCACTGG + Intronic
973810297 4:54563009-54563031 TTATTTTAATTGAAAATTAAGGG - Intergenic
974021056 4:56692869-56692891 TTTTTTTAATTGATCATTCTTGG + Intergenic
974354883 4:60798542-60798564 TTTTTTTAATAAATGAAAAATGG - Intergenic
974589400 4:63923986-63924008 ATTTTTTAATTGAAAATTAATGG + Intergenic
974684783 4:65213402-65213424 TTTTTTTATTTCATGATAACTGG - Intergenic
974854396 4:67442019-67442041 TTTTTTTAATTTAAGTTCTAGGG - Intergenic
975222979 4:71835161-71835183 TTTTTGTAACTAAAGATCAATGG + Intergenic
975360649 4:73466695-73466717 TTTTTTTTCTTGATGATTAGAGG - Intergenic
975534040 4:75430193-75430215 TTTTTTCAATTAAAAATCAATGG - Intergenic
975539614 4:75493637-75493659 TTTTTTTAAATAATGAAAAAGGG + Intronic
975633633 4:76424277-76424299 TTTTTTTAATTGATCATTCTTGG - Intergenic
975793500 4:77983175-77983197 TTTTTTTAATTGATCATTCTTGG + Intergenic
976007149 4:80443253-80443275 ATTTTTGCATTGATGCTCAAGGG - Intronic
976016989 4:80567632-80567654 TCTGTTGAATTGATGCTCAAAGG + Intronic
976060736 4:81125415-81125437 TTTTTTAAACTGACAATCAAAGG - Intronic
976295765 4:83469914-83469936 TTTTTTTAATTGATTGATAAAGG - Intronic
976695238 4:87912210-87912232 TTTCTGTAATTCATGATAAAGGG + Intergenic
977035377 4:91944459-91944481 CTTCTTTAATTGATGATTATAGG - Intergenic
977043286 4:92040298-92040320 TTTTTTCCAGTGAGGATCAAGGG + Intergenic
977407182 4:96614718-96614740 TTTTTTTAACTCATGACTAAAGG - Intergenic
977550640 4:98439138-98439160 TTTTTTTCATTCATAATGAAAGG + Intronic
977846051 4:101768569-101768591 TTATTTCAATTGATGATGAAAGG - Intronic
978295272 4:107197559-107197581 TTTTTTTTCTTGAAGATAAATGG - Intronic
978322177 4:107509738-107509760 TTTTTTTTTTTGCTGAGCAAGGG - Intergenic
978820078 4:112957026-112957048 TTTTTTTAATTGATCATTCTTGG + Intronic
978865433 4:113503475-113503497 TTTTTTTAAGTGTTGTCCAATGG - Intronic
979178596 4:117696714-117696736 TTTTTCTAATTAATGAGCATGGG - Intergenic
979411635 4:120385856-120385878 TTTTCTTATTGGATGATTAAAGG + Intergenic
979488426 4:121295714-121295736 TTTTTCCAATTTATGAACAAAGG - Intergenic
979641292 4:123015196-123015218 TTTTTTTAATTGATCATTCTTGG + Intronic
980373922 4:131917683-131917705 TATTTTTAATTGATGTTTCATGG + Intergenic
980504734 4:133702303-133702325 TTTTTTTCATTGAAGATTTATGG - Intergenic
980550792 4:134331617-134331639 TTTTTTTCTTTGAAGATTAAAGG + Intergenic
980733867 4:136856655-136856677 TTTTTTTAAATAATGGTAAAAGG - Intergenic
980748104 4:137048043-137048065 TTTTTTTATTTGCTGATCTCTGG - Intergenic
980883808 4:138740113-138740135 TTTTTTTAATTGATCATTCTTGG - Intergenic
981011626 4:139931152-139931174 TTTTTATAATTTTTGATCAAGGG - Intronic
981180567 4:141737941-141737963 TTTATTTTTTTGGTGATCAAAGG + Intergenic
981362461 4:143863210-143863232 CTTTTTTAAAGGATTATCAAGGG + Intergenic
981373187 4:143983973-143983995 TTTTTTTAAAGGATAATGAAGGG + Intergenic
981378591 4:144044407-144044429 TTTTTTTTATTGAAGTTCTAGGG - Intergenic
981382287 4:144087248-144087270 CTTTTTTAAAGGATAATCAAGGG + Intergenic
981874457 4:149523830-149523852 TATTTTTACTTGAAGATCATTGG - Intergenic
982723649 4:158882979-158883001 TTTTTTTAATTGATCATTCTTGG - Intronic
982754768 4:159204993-159205015 TTTTTTAAAATTATGAGCAAAGG - Intronic
982799609 4:159687786-159687808 TCCTTTTAACTGATGATAAAAGG + Intergenic
982881007 4:160715586-160715608 TATTTTTGAATGATGATTAAAGG + Intergenic
982967983 4:161938876-161938898 TTTTTTTAATTGGTGACATAAGG + Intronic
983236028 4:165180377-165180399 TTTTTTTAATTGGTACTCACTGG + Intronic
983300241 4:165915908-165915930 TTTTTTTAAGTGATTTTGAATGG - Intronic
983886962 4:172990319-172990341 TTTTTTTAATTTTTGTTCATAGG + Intronic
983998241 4:174211877-174211899 TAATTTTATTTGATCATCAAAGG - Intergenic
984250977 4:177334225-177334247 TTTTTATAGTTTAAGATCAAAGG + Intronic
984813576 4:183818108-183818130 TTTTTTTAATTGATCATTCTTGG + Intergenic
985071922 4:186174093-186174115 TTTTTTTACTTGAAGTTCAGGGG + Intergenic
985216515 4:187658848-187658870 TTTTTTTAATTGATCATTCTTGG - Intergenic
985736753 5:1587286-1587308 TTTTTTTAATTGATCATTCTTGG - Intergenic
985934226 5:3082362-3082384 GGTTTTGAATTGTTGATCAACGG + Intergenic
986491716 5:8298875-8298897 TTTTCTTGAATGATGAACAAAGG - Intergenic
986936718 5:12897592-12897614 TATTTTTAAGTAATGATTAAAGG - Intergenic
987149282 5:15022566-15022588 TTTTTTTCAATGATGAGCAGTGG - Intergenic
987213271 5:15706572-15706594 TTGTTTTAATAGTTCATCAAAGG + Intronic
987655296 5:20798398-20798420 TTTTTGGCATTGATTATCAAGGG + Intergenic
987977620 5:25034769-25034791 TTCTTGTAATAGATGATAAAAGG + Intergenic
988023079 5:25649420-25649442 TTTTTTTCACTAATGATTAAAGG + Intergenic
988768263 5:34405504-34405526 TTTTTGGCATTGATTATCAAGGG - Intergenic
989039762 5:37215753-37215775 TTTTTTTTTTTGAAGATAAACGG + Intronic
989068015 5:37483114-37483136 TTTTTTTAATTGATCATTCTTGG + Intronic
989075597 5:37562455-37562477 TTTTTTTAATTGATCATTCTTGG + Intronic
989095773 5:37779929-37779951 TTTTTTCCAGTGAGGATCAAGGG + Intergenic
989575207 5:42981358-42981380 TTTTTTTAATTGATCATTCTTGG - Intergenic
989575257 5:42981822-42981844 TTTTTTTAATTGATCATTCTTGG - Intergenic
989587371 5:43086538-43086560 TTTTTTTAATTGATCATTCTTGG + Intronic
989638411 5:43559654-43559676 TTTTATTAATTTATGGTGAAAGG + Intergenic
990297657 5:54420052-54420074 TTTTTTTAATTGATCATTCTTGG + Intergenic
990498765 5:56373458-56373480 TTTTTTTAATTGATCATTCTTGG - Intergenic
991073455 5:62512616-62512638 TTTTTTTAATTGATCATTCTTGG + Intronic
991127244 5:63083227-63083249 TTTTTTTAATTGATCATTCTTGG + Intergenic
991597756 5:68323114-68323136 TTTTTTTAATTGATCATTCTTGG + Intergenic
991672444 5:69062275-69062297 TTTTTTTAATTGATCATTCTTGG + Intergenic
991762588 5:69934787-69934809 TTTTTTTAATCCATGAACATGGG - Intergenic
991784737 5:70183339-70183361 TTTTTTTAATCCATGAACATGGG + Intergenic
991841816 5:70809827-70809849 TTTTTTTAATCCATGAACATGGG - Intergenic
991877185 5:71183714-71183736 TTTTTTTAATCCATGAACATGGG + Intergenic
992463392 5:76983875-76983897 TTTTTTTAATTGATCATTCTTGG + Intergenic
992890031 5:81195582-81195604 TTTTTTTGATAGATAAACAAAGG + Intronic
993233525 5:85270860-85270882 GATTTTTAATTGATAATCATAGG - Intergenic
993768885 5:91899334-91899356 TTTTTCTAATTGATGTTGCAAGG + Intergenic
993812111 5:92493552-92493574 CTTTTCTAATTTATGACCAAAGG + Intergenic
994728754 5:103466981-103467003 TATTTCTAATTGATTGTCAAAGG - Intergenic
994855801 5:105117412-105117434 TTTTTTTAATTGGAGAAAAATGG - Intergenic
995272057 5:110232085-110232107 TTTTTGCAATACATGATCAAGGG - Intergenic
995411878 5:111867125-111867147 TTTTTTTAATTAAAGTTCTAGGG - Intronic
995772934 5:115691227-115691249 TTTTTTTAATTGATCATTCTTGG - Intergenic
995780090 5:115765843-115765865 TTTTTTTAAATGATTATGGATGG + Intergenic
995973187 5:117998243-117998265 ATTTTTTTATTGAAGAGCAAAGG - Intergenic
996146137 5:119979426-119979448 TTTTGTTAAGTGATGATGAATGG - Intergenic
996320871 5:122214157-122214179 TTTTTTTAATAGACGATGAATGG + Intergenic
996376207 5:122810384-122810406 TTTTTTTAATTGATCATTCTTGG - Intronic
996386137 5:122912745-122912767 TTTTTTTAATTGATCATTCTTGG + Intronic
996642111 5:125768509-125768531 TTTTATTAATTAATAATAAAGGG - Intergenic
996653407 5:125910846-125910868 TCTTTTTAAATAATGATAAAGGG - Intergenic
996803693 5:127430903-127430925 TTTTTATAATTTATATTCAAAGG + Intronic
997095701 5:130908618-130908640 CTATTTTAATTGATGTTCACTGG + Intergenic
997320972 5:132978348-132978370 TTTTTTTAAAAAATGGTCAAAGG + Intergenic
997636432 5:135409958-135409980 TTTTTTTAATTGATCATTCTTGG - Intergenic
998298567 5:140995676-140995698 TTTTTTTAATTGTTAAATAAAGG + Intronic
998337527 5:141386366-141386388 TGTTTTTAATTAATACTCAAAGG - Intronic
998541401 5:142985517-142985539 TTTTTTTAATTTAAGTTCTAGGG + Intronic
998690049 5:144577669-144577691 TTTTTATAAGTTTTGATCAAAGG + Intergenic
998765360 5:145480592-145480614 TTTATTTCATTGATCTTCAATGG + Intronic
999369304 5:151043899-151043921 TTTATTTAGTTGATGATGTAGGG - Intronic
999455512 5:151713413-151713435 TTTTTTTAATTGATCATTCTTGG + Intergenic
999757270 5:154673837-154673859 TTTTTTTTAATGATTAGCAAAGG + Intergenic
999987195 5:157015066-157015088 TTTTTTTAATTGATCATTCTTGG - Intergenic
1000719257 5:164685711-164685733 TTTTATTAGTTGATGATCCTAGG - Intergenic
1000733362 5:164865389-164865411 CTTTTTTGATGTATGATCAAAGG - Intergenic
1000805265 5:165782807-165782829 TCTTTTTTCTTGATGATCAGAGG + Intergenic
1001565765 5:172698171-172698193 TTTTTTTTTTTGATGGCCAAAGG - Intergenic
1001725352 5:173892440-173892462 TTCTTTAAATTTATGTTCAAAGG - Intronic
1002488431 5:179555812-179555834 TTTTTTTAATTGATCATTCTTGG + Intronic
1002501405 5:179649834-179649856 TTTTTTTAATTGATCATTCTTGG + Intergenic
1002658170 5:180770687-180770709 TTTTTTTAATTGATCATTCTTGG + Intergenic
1002786791 6:407257-407279 TTTTTTTACATGTTGATCTATGG + Intronic
1002894911 6:1372475-1372497 TTTTCTTAATTTCTGATCATTGG + Intergenic
1003407156 6:5834894-5834916 TTTTTTTAATTGATCATTCTTGG + Intergenic
1003630870 6:7785919-7785941 TTTTTTTAATAAAGGTTCAAGGG - Intronic
1003660565 6:8056904-8056926 TCTTTTAAATTGATTATTAATGG - Intronic
1003869260 6:10389037-10389059 TTTTTTCCCATGATGATCAAGGG - Intergenic
1004166813 6:13264405-13264427 TTTTTTTAATGGATGAAAATGGG - Intronic
1004361490 6:14975162-14975184 TTTTTTTTTTTGGTGATAAATGG - Intergenic
1004402823 6:15304607-15304629 TTTTTTAAAGAGATGATTAAAGG - Intronic
1004663973 6:17734681-17734703 TTTTTTTAATTGATCATTCTTGG + Intergenic
1004874893 6:19941134-19941156 TTTTTTTAATTGATCATTCTTGG - Intergenic
1004875891 6:19954207-19954229 ATTTTTAAATTTATGATCATTGG + Intergenic
1005249936 6:23933513-23933535 TTTTTTCAATTTATGAACATGGG - Intergenic
1005735875 6:28745549-28745571 TGCATTTATTTGATGATCAATGG - Intergenic
1005879820 6:30047562-30047584 TTGTTTTAATTGCTGATCTTAGG - Intergenic
1006141209 6:31931275-31931297 TTTTTTTAATTGATCATTCTTGG + Intronic
1006209574 6:32384200-32384222 TTTTTTTAATTGATCATTCTTGG + Intergenic
1006263780 6:32898361-32898383 TTTTTTAAATTAATGATAATGGG - Intergenic
1006827003 6:36942455-36942477 TTTTTTTAATTGATCATTCTTGG - Intergenic
1007846566 6:44762809-44762831 TTTTTTTAATTTAAGTTCAAGGG + Intergenic
1008049748 6:46888118-46888140 TTATTTTAAATGGTGACCAAAGG - Intronic
1008076722 6:47153299-47153321 TGTTTGTTATTGATGATAAATGG - Intergenic
1008251910 6:49250623-49250645 TTTTTTTAATTGAAGAAACAGGG - Intergenic
1008387329 6:50906900-50906922 TTCTTTTAATTCATGAACAGAGG - Intergenic
1008666155 6:53718558-53718580 TATTTTTAATTGAAGAAAAATGG + Intergenic
1009005428 6:57780751-57780773 TTTTTTTAATCCATGAACATGGG + Intergenic
1009244115 6:61213800-61213822 GTTTTCTAATTGGTGACCAATGG - Intergenic
1009419423 6:63448588-63448610 TTTTTTTTTTTAATGATCGAGGG - Intergenic
1009639991 6:66322380-66322402 TTTTTTTAGTTGAAAATCACAGG + Intergenic
1010030133 6:71265425-71265447 TTTTTTTAATTGATCATTCTTGG + Intergenic
1010288372 6:74106674-74106696 TTTTTTTTTTTGATGAGCACTGG - Intergenic
1010289531 6:74119446-74119468 TTTTTTTAGTTTAAGATCTAGGG + Intergenic
1010802172 6:80188778-80188800 TATTTTTATTTTATGTTCAAGGG - Intronic
1010899688 6:81410670-81410692 TTTTTTATATTTTTGATCAATGG - Intergenic
1010905498 6:81481831-81481853 TATTTTAAATAGAAGATCAAAGG + Intergenic
1011201957 6:84846569-84846591 TTTTTTTCATTGTTGATAAACGG + Intergenic
1011292945 6:85795479-85795501 TTGTTTTAATTGAAGGACAAGGG + Intergenic
1011363915 6:86559237-86559259 TTTTTGTAGTTGATGATGACTGG - Intergenic
1011426596 6:87238693-87238715 TTTTTTTAATTGATCATTCTTGG + Intronic
1011429446 6:87269672-87269694 TTTTTTTAATTTAAGTTCAGAGG + Intergenic
1011500266 6:87980748-87980770 ATTTTATATTTGATTATCAATGG - Intergenic
1011855781 6:91688920-91688942 TTTTTTTAACTATTGATAAAAGG - Intergenic
1012353595 6:98285024-98285046 TTTTTTAAATAGAGGATAAAAGG + Intergenic
1012479203 6:99649542-99649564 TTTTTTTAATTGATCATTCTTGG + Intergenic
1012830161 6:104194386-104194408 TTCTTTTAATCGATGACCATGGG - Intergenic
1013204956 6:107935772-107935794 TTTTTTTAATTGATCATTCTTGG - Intronic
1013207040 6:107954449-107954471 TTTTTTTAATTGATCATTCTTGG - Intronic
1013227829 6:108133332-108133354 CTTTTTCAAGTGATCATCAATGG - Intronic
1013530615 6:111016695-111016717 TTTTTTTAATTGATCATTCTTGG + Intronic
1013658926 6:112274520-112274542 TTTTTTTACTTGATGATACATGG - Intergenic
1013747566 6:113363960-113363982 TTTTTTTAATTTAAGAACACTGG - Intergenic
1014092006 6:117414646-117414668 TTTTTTTGGTTGTTTATCAATGG - Intronic
1014212598 6:118722149-118722171 TTTTTTTAATTAAAGGACAAAGG + Intergenic
1014516897 6:122390362-122390384 TTTTTTTATTCGTTCATCAATGG - Intergenic
1014524434 6:122484740-122484762 TTTTCCTAAATGATGATCCACGG - Intronic
1014643997 6:123951831-123951853 TTTTATTAATTGTTGATTTATGG + Intronic
1014797842 6:125747542-125747564 TTTTTTTCAGTGATGATCTCAGG + Intergenic
1015065235 6:129017865-129017887 TTTTTTTAAGTTAGCATCAAGGG + Intronic
1015093996 6:129392849-129392871 TTATTTTAATTAATTATAAATGG + Intronic
1015145749 6:129984469-129984491 TTTTTTTAGTGGTTGATCTAGGG - Intergenic
1015681852 6:135817511-135817533 TTATTTTAATTGATGCACAATGG + Intergenic
1016205658 6:141465717-141465739 TTTATTTAATAGAGGGTCAAAGG - Intergenic
1016813038 6:148279683-148279705 TTTTTTAAAATGATGATGGATGG - Intronic
1017214812 6:151898411-151898433 TTTTTTTAATTGATCATTCTTGG + Intronic
1017338838 6:153295972-153295994 TTATGATAATTGATGGTCAAGGG + Intergenic
1017357933 6:153531954-153531976 TTTTTCCAATTCATGATCATGGG + Intergenic
1017419934 6:154263257-154263279 TTTTTTTAATTGATCATTCTTGG + Intronic
1017529006 6:155268931-155268953 TTTTTTTAATTGATCATTCTTGG - Intronic
1017660865 6:156671148-156671170 TTTTTTTAATTGATCATTCTTGG - Intergenic
1017857554 6:158363981-158364003 TTTTTTTAATTTATTTTGAAAGG - Intronic
1017868837 6:158469061-158469083 TATTTTTATTTTATGAGCAAGGG + Intronic
1017893859 6:158662093-158662115 TTATATTAATTTATGATCCATGG - Intronic
1018052173 6:160020196-160020218 TTTTTTTTAGTGATTATAAATGG - Intronic
1018193218 6:161329620-161329642 TTTTTTTAAAAGAAGCTCAATGG - Intergenic
1018965143 6:168479241-168479263 TATCTTAAATTGCTGATCAATGG - Intronic
1019781938 7:2945639-2945661 TTATTTTGCTTGATGATGAAAGG - Intronic
1020032454 7:4942436-4942458 TTTTTTTAATTAATTAGAAATGG + Intronic
1020407866 7:7856981-7857003 TTTTTATAGTTGATGATCCCAGG + Intronic
1020545928 7:9530150-9530172 ATTTTTTTATTGATTATCAGAGG + Intergenic
1020546355 7:9537139-9537161 TTTTTTTAATTAATGAAAATAGG - Intergenic
1020754605 7:12186327-12186349 TTCTTTTAATTGATAACCAATGG + Intergenic
1021829169 7:24586160-24586182 TTTTTTTAATTGAAGATGTTAGG + Intronic
1022250680 7:28604786-28604808 TTATTTTAATTGATGTAGAAAGG + Intronic
1022590786 7:31660324-31660346 TTTCCTTTATTTATGATCAAAGG + Intergenic
1023283467 7:38594849-38594871 TTTTTTCAAATGATGATCTTAGG + Intronic
1023774188 7:43588157-43588179 TTTTTTTAAATTATTATCATTGG + Intronic
1024382002 7:48707503-48707525 TTTTTTTAATTTATGATGAATGG + Intergenic
1024434690 7:49337415-49337437 TTATTTTCAATCATGATCAATGG + Intergenic
1024626024 7:51209031-51209053 TTTTTTTAATTGATCATTCTTGG - Intronic
1024756001 7:52532157-52532179 TTTTTTGATTTAATGAGCAATGG + Intergenic
1024764969 7:52647117-52647139 TGTTTTTAATTATTCATCAATGG + Intergenic
1024813152 7:53236596-53236618 TTTCTTTAATAGAAGATAAATGG + Intergenic
1024931023 7:54667035-54667057 TTTTTTTAATTGATTATTCTTGG + Intergenic
1025795701 7:64737799-64737821 TTTTTTTAATTGATCATTCTTGG + Intergenic
1026042092 7:66876780-66876802 TTTTTTTAATTGATCATTCTTGG + Intergenic
1026402776 7:70032517-70032539 TTTTTTTTAAGGATGATCATAGG - Intronic
1026571047 7:71531220-71531242 TATTTTTAATTGATGCATAATGG - Intronic
1026581320 7:71620599-71620621 TTTATTTAATTGATGCATAACGG + Intronic
1027361219 7:77412632-77412654 TTTTTTTAATTGATTATTTTAGG - Intronic
1028259842 7:88649339-88649361 TTTTTTAAACTGAGGATTAAAGG - Intergenic
1028286491 7:89009487-89009509 TAATTTTAATTGATGTGCAATGG + Intronic
1028332651 7:89614961-89614983 AATTTTTAATTGATCATAAAAGG - Intergenic
1028422520 7:90649472-90649494 TTTTTTTAATTAAAGTTCTAGGG + Intronic
1028585264 7:92446188-92446210 TACTGTTAATTGGTGATCAACGG - Intergenic
1029334252 7:99887321-99887343 TTTTTTTAATTGATCATTCTTGG + Intronic
1029941310 7:104483421-104483443 GCTTTTAAATTGATGATCTATGG + Intronic
1030368528 7:108672372-108672394 TTTTTTTAATTGATCATTCTTGG - Intergenic
1030663027 7:112242693-112242715 TTCTTTTAATTCATGAGCATGGG - Intronic
1030971472 7:116062605-116062627 TTTTTTTACTTGTTGATTGATGG + Intronic
1031496103 7:122450000-122450022 TTTTTTTAAATGATATTGAAAGG - Intronic
1031502009 7:122529950-122529972 GTTTTCTAATTGTAGATCAAAGG - Intronic
1031791219 7:126107426-126107448 TTATTTTAATCCATGAACAAGGG - Intergenic
1032288304 7:130561377-130561399 ATCTTTTAATAAATGATCAACGG + Intronic
1032377297 7:131433502-131433524 TTTCATTAATGGATGATAAAAGG - Intronic
1032484785 7:132277266-132277288 TTTTTTTAACTGGTGAAGAAAGG + Intronic
1032589500 7:133178298-133178320 TTTTTTTAATTGATCATTCTTGG - Intergenic
1032730442 7:134637082-134637104 TTTTCTTAATTGTTGTCCAAGGG - Intergenic
1033179305 7:139159426-139159448 TTTTATTAATTTATGTACAAGGG + Intronic
1033333241 7:140432372-140432394 TTTTTTTAATTGATCATTCTTGG - Intergenic
1033375969 7:140762619-140762641 TTTTTTTAATTGATCATTCTTGG + Intronic
1033621230 7:143063505-143063527 TTTTTTTAATTGATCATTCTTGG - Intergenic
1033859000 7:145601155-145601177 TTTTTATAATTAATGATCAAAGG - Intergenic
1034791089 7:153968984-153969006 TTTATTTATCTGTTGATCAATGG + Intronic
1035540093 8:427810-427832 TTTTTAAAATTGCTAATCAAGGG - Intronic
1035963467 8:4163824-4163846 ATTTTTGAATTAATGATGAAGGG - Intronic
1035980451 8:4364522-4364544 TTTTTTAAAAAGATAATCAATGG + Intronic
1036737419 8:11330899-11330921 TTTTTTTAATTGATCATTCTTGG - Exonic
1036762678 8:11521277-11521299 TTTTATTAATTGTAAATCAAAGG - Intronic
1037574209 8:20185426-20185448 TTTTTTTATTCTATGATTAAAGG - Intergenic
1038093962 8:24286654-24286676 TTTTTTTAATTTAGGTTCCAGGG - Intergenic
1038443957 8:27590204-27590226 TTTTTTTAATTGATTCTAAGGGG - Intergenic
1039094630 8:33870210-33870232 TTTCTTTAATTCATGACCCAGGG - Intergenic
1041107436 8:54457460-54457482 ATTTTTAAATTTATTATCAACGG + Intergenic
1041398851 8:57419892-57419914 TTGATTTAATTGAGGTTCAAGGG - Intergenic
1041703988 8:60825850-60825872 TTTTTTTAATTTAAGTTCTAGGG + Intronic
1042083288 8:65080443-65080465 TATTGTTAATTGATTATTAATGG - Intergenic
1042134159 8:65617602-65617624 TTTTTTTAATTGATCATTCTTGG - Intronic
1042290552 8:67166736-67166758 TTTTTTTAATTGATCATTCTTGG + Intronic
1042571853 8:70173836-70173858 TTTTTTCAGTTGATGCTTAAAGG - Intronic
1042676466 8:71327289-71327311 TCTTTTTAATTGTTCATAAAAGG - Intronic
1042883158 8:73516839-73516861 TTTTTTAAAGTGATGATCAATGG - Intronic
1042921809 8:73927563-73927585 TTTTTTTAGTTGGTTATAAAAGG - Intergenic
1043362074 8:79485246-79485268 TTTTTTTAATTGATCACCTTTGG + Intergenic
1043574114 8:81637506-81637528 TCATTTTAATTGATGCTTAAAGG + Intergenic
1043574401 8:81641585-81641607 TGTTTTAAAATGATGATTAATGG - Intergenic
1043828852 8:84963381-84963403 TTTTTTTAATTAAAGTTCTAGGG - Intergenic
1043961414 8:86423236-86423258 TTTTTTTAATTGATCATTCTTGG + Intronic
1044224047 8:89700114-89700136 TTTTTTTAATTGATCATTCTTGG - Intergenic
1044420044 8:91984132-91984154 TATTTTTTAGTGATGTTCAATGG - Intronic
1044506074 8:93021077-93021099 TTTTTTTAATTACTGAACATAGG - Intergenic
1044507829 8:93040193-93040215 TTTTTTTAATTGATCATTCTTGG - Intergenic
1044812742 8:96080859-96080881 TTTTTTTAATTTATGATGTGTGG + Intergenic
1044943077 8:97363118-97363140 TTTTTTTAATTAATAGTCTAGGG - Intergenic
1045135138 8:99208643-99208665 TTATTTTAATTAATGATTCATGG + Intronic
1045195796 8:99928009-99928031 TTTTTTTAATTGATCATTCTTGG - Intergenic
1045820762 8:106335304-106335326 TTATTTTAATTGTTGATTTACGG + Intronic
1046189341 8:110771065-110771087 TTTCCATAATTGATGTTCAAGGG - Intergenic
1046240169 8:111479218-111479240 TTTTACTATTTGATGAGCAAAGG - Intergenic
1046428619 8:114090802-114090824 ATTTTTTATTTGATGAGTAAAGG + Intergenic
1046549946 8:115703374-115703396 TCTTTTTAATAGCTGATAAACGG - Intronic
1047103841 8:121711278-121711300 TTTTTATAAAAGATGAGCAATGG + Intergenic
1047388434 8:124431324-124431346 TTTTTTTAATTGATCATTCCTGG + Intergenic
1047460706 8:125062015-125062037 TTTTTTTGTTTGTTTATCAATGG + Intronic
1048061344 8:130922221-130922243 TTTTTTTAATTGATCATTCTTGG + Intronic
1048581912 8:135735839-135735861 CTTTCTCAGTTGATGATCAAAGG + Intergenic
1049739505 8:144230820-144230842 TTTTTTTAATTGATCATTCTTGG + Intronic
1050571764 9:6948496-6948518 TTTTTTTAATTGATCATTCTTGG + Intronic
1050849673 9:10267751-10267773 TTTTTTTAATTGATAACAACAGG + Intronic
1051414421 9:16824118-16824140 TTTTTATGACTGATTATCAAAGG - Intronic
1051911852 9:22161900-22161922 TATTTTTAATTTTTGATCAAGGG + Intergenic
1052858907 9:33424394-33424416 TTTTTTTAATTGATCATTCTTGG - Intergenic
1052888077 9:33668339-33668361 TTTTTTTAATTGATTATTCTTGG - Intergenic
1053638904 9:40047903-40047925 TCTTTTTAATTGATGTTTCATGG + Intergenic
1054545846 9:66328802-66328824 TCTTTTTAATTGATGTTTCATGG - Intergenic
1054857079 9:69912556-69912578 TTTTTTTAAGTCATGACTAAGGG - Intergenic
1054969942 9:71073628-71073650 TTTTTTTTATTGATAATCTATGG - Intronic
1055238344 9:74152248-74152270 TTTTTTAATTTTAAGATCAAGGG + Intergenic
1055403133 9:75945647-75945669 TTTTTTTAAGTTATCTTCAAGGG + Intronic
1055447259 9:76395282-76395304 TTTTTTAAATTTTTAATCAATGG + Intergenic
1055518746 9:77060165-77060187 TTTTTTTAATTGATCATTCTTGG + Intergenic
1055767293 9:79677556-79677578 TTTTTTGAATTGGTAATCATGGG + Intronic
1056145976 9:83729362-83729384 TTTTTTTAATTGATCATTCTTGG - Intergenic
1056430457 9:86522780-86522802 TTTTGTTAATTGATAATATATGG + Intergenic
1056601302 9:88049210-88049232 TTTTTTTATGTGATGTTAAATGG + Intergenic
1056987421 9:91376265-91376287 TTTTTATAATTATTTATCAATGG + Intergenic
1057097870 9:92328310-92328332 TTTTTTTAAGTGATTATAAGTGG + Intronic
1057145109 9:92753500-92753522 TTTTTAAAATTAATGATAAAAGG + Intronic
1057154569 9:92830076-92830098 TTTTTTTAATTGATCATTCTTGG + Intergenic
1057257850 9:93565684-93565706 TTTTTTTTTTTTAAGATCAAAGG - Exonic
1057543649 9:96000629-96000651 TTTTTTTAATAGAAGTTCAATGG - Intronic
1057922559 9:99109231-99109253 TTTTTTTAATTGCTGATAAAAGG + Intronic
1058916911 9:109576337-109576359 TCTCTTTAATTTATTATCAACGG - Intergenic
1059688612 9:116661992-116662014 TTTTTTTAATTTAAGTTCTAGGG - Intronic
1059707634 9:116839888-116839910 TTTTTTTAATTGATCATTCTTGG + Intronic
1059837700 9:118175119-118175141 TTTATTTAGTTGTTGATAAATGG + Intergenic
1060006768 9:120007405-120007427 TTTTTTTAATTGCTGCTGAAGGG - Intergenic
1060065743 9:120499043-120499065 TTTGTTTAAATCATGATCCAAGG - Intronic
1060369479 9:123056492-123056514 TTTTTTTAATTGATCATTCTTGG + Intronic
1060471230 9:123950189-123950211 TTTTTTTAATTTAGGAGCAGAGG + Intergenic
1060669596 9:125458228-125458250 TTTTTTTAATTGATCATTCTTGG + Intronic
1061143299 9:128781132-128781154 TTTTTTTAATTGATCATTCTTGG - Intergenic
1061636031 9:131908859-131908881 TTTTTTTAATTGATCATTCTTGG - Intronic
1061846605 9:133391826-133391848 TTTTTTTAATTGATCATTCTTGG - Intronic
1061943612 9:133895943-133895965 TTTTTTTAATTGATCATTCTTGG + Intronic
1202786776 9_KI270719v1_random:31506-31528 TCTTTTTAATTGATGTTTCATGG + Intergenic
1203463662 Un_GL000220v1:67366-67388 TTTTTTTAATTGATCATTCTTGG + Intergenic
1185541633 X:907107-907129 TTTTTTTAATTAATGAGGCACGG - Intergenic
1185802266 X:3022905-3022927 TTTTTTAAATTAATGTTCATCGG + Intronic
1185812936 X:3127452-3127474 TTTTTTTAATCGATGCATAATGG - Intergenic
1186177347 X:6938613-6938635 TTTTTTTAATTTAAGTTCTAGGG - Intergenic
1186244672 X:7608013-7608035 TTTTTTTAATTGATCATTCTTGG + Intergenic
1186625980 X:11294434-11294456 TATTTATAATTAATGATTAAAGG - Intronic
1186783651 X:12939428-12939450 TTTTTTTAAATGGAGCTCAATGG - Intergenic
1186856625 X:13632615-13632637 GTTTTTTATTAGATGTTCAAGGG + Intronic
1186922853 X:14302105-14302127 TTTTTTTAATTGATCATTCTTGG + Intergenic
1188458949 X:30400092-30400114 ATTTTTTAAATGATGCTGAATGG + Intergenic
1188701505 X:33270155-33270177 TTTTTTTCATATATCATCAATGG + Intronic
1188746336 X:33849066-33849088 TTTTTTTTTTTGATGATTCAGGG + Intergenic
1188859176 X:35236525-35236547 TTTGTTTAATTGAGAATCAAAGG + Intergenic
1188920473 X:35970171-35970193 TTTTTTTAATTGAAAATATATGG + Intronic
1189438616 X:41014627-41014649 TTTCTTTAATTGATACCCAAGGG - Intergenic
1189458175 X:41212444-41212466 TTTTTTTAATTGATCATTCTTGG - Intronic
1189506206 X:41613614-41613636 TTTTTTTAATTGATCATTCTTGG - Intronic
1189534845 X:41924885-41924907 TTTTTTTAAATGCAGATCAGAGG + Intergenic
1190769831 X:53505050-53505072 TTTTTTTAATTGATCATTCTTGG - Intergenic
1190838987 X:54128484-54128506 TTTTTTTAATTGATCATTCTTGG + Intronic
1190867300 X:54395690-54395712 TTCTTTTAATTTATGAAGAAAGG + Intergenic
1191010313 X:55750033-55750055 TTTTTTTAATTGATCATTCTTGG - Intronic
1191029126 X:55948956-55948978 ATTTTTAAATAGATCATCAATGG + Intergenic
1191639494 X:63414842-63414864 TTTTTTCCAGTGAGGATCAAGGG - Intergenic
1192021600 X:67398375-67398397 TTCTTTTAATTGATGATGTTAGG - Intergenic
1192387030 X:70680564-70680586 TTTTTTTAATTGATCATTCTTGG - Intronic
1192629196 X:72761973-72761995 TCTTTTTAATTGAGGTTCAAGGG + Intergenic
1192652514 X:72958841-72958863 TCTTTTTAATTGAGGTTCAAGGG - Intergenic
1192878476 X:75257754-75257776 TTTTTTTAAGGGATCATAAAAGG - Intergenic
1193112784 X:77746366-77746388 TTTTTTTAATTAATGAAAAGAGG - Intronic
1193292127 X:79787391-79787413 TTTTTTTAAATGGTGATTTAAGG - Intergenic
1194074064 X:89366828-89366850 TATTTTTAATTTATGAACATTGG + Intergenic
1194320888 X:92444736-92444758 TTTTTTTTTTTAATGATGAAGGG + Intronic
1194432848 X:93832271-93832293 TTTTTTTAATTGCTGACACAGGG + Intergenic
1194966625 X:100296195-100296217 TTGTTTTAATTGCTCACCAATGG - Exonic
1195273556 X:103255940-103255962 TCTTTTTCATTGATGACCACTGG + Intergenic
1195955468 X:110324657-110324679 TTTTTTTAATTTATCATGACAGG + Intronic
1196459798 X:115918304-115918326 TTTTTTCCAGTGAGGATCAAGGG + Intergenic
1196522558 X:116691593-116691615 TTCTTGTAATTGAAGATGAAAGG + Intergenic
1196782387 X:119395304-119395326 TTTTTTAAATTGATGATACATGG + Intergenic
1196994024 X:121361101-121361123 TTTATTTACTTGTTGATCAGTGG + Intergenic
1197966094 X:132063549-132063571 TTTTTTAAATTGAAGATTAATGG + Intergenic
1198260564 X:134961135-134961157 TTTTTTTAATTGATCATTCTTGG - Intergenic
1198476050 X:136999363-136999385 TTTTTTTAATTGATCATTCTTGG + Intergenic
1200393803 X:155970815-155970837 TTTTTTCCAGTGAGGATCAAGGG + Intergenic
1200729453 Y:6718353-6718375 TATTTTTAATTTATGAACATTGG + Intergenic
1200742867 Y:6872935-6872957 AATTTTTAATTAATAATCAAAGG + Intronic
1200952765 Y:8917498-8917520 TTTTTTTAATTGATCATTCTTGG + Intergenic
1200972528 Y:9169176-9169198 TTTTTTAAATTAATGATCTTAGG - Intergenic
1201779384 Y:17702093-17702115 TTTTTTATATTGATCCTCAATGG + Intergenic
1201822172 Y:18203899-18203921 TTTTTTATATTGATCCTCAATGG - Intergenic
1202138493 Y:21695077-21695099 TTTTTTAAATTAATGATCTTAGG + Intergenic