ID: 953250479

View in Genome Browser
Species Human (GRCh38)
Location 3:41242151-41242173
Sequence AAATATCCACAGATGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953250474_953250479 20 Left 953250474 3:41242108-41242130 CCATTGATCATCAATTAAAAAAA 0: 1
1: 0
2: 19
3: 44
4: 952
Right 953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG 0: 1
1: 0
2: 1
3: 17
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953250479 Original CRISPR AAATATCCACAGATGGAGCA AGG Intronic
902151018 1:14443403-14443425 ACACATCCAGAGATGGAGGATGG + Intergenic
902238263 1:15071617-15071639 AAATATGCAAATATGCAGCACGG + Intronic
903003611 1:20283904-20283926 AAATAGCCAGTGATGGAACAAGG + Intergenic
905277387 1:36827309-36827331 AAATATCCACAGAAGCCCCAGGG - Intronic
911118837 1:94274786-94274808 AAACAGCAACAGCTGGAGCATGG + Intronic
916129987 1:161604617-161604639 AAATAGCCACCTATGGAGTAAGG + Intronic
916378635 1:164183938-164183960 ACATATCCACTGTTGGAGAATGG - Intergenic
916917049 1:169418247-169418269 AAATATCTACAAATGAAGAATGG + Intronic
917118056 1:171622289-171622311 AAATCTCCACAGATGTCGCAGGG - Intergenic
917476408 1:175373065-175373087 AAACATGCACAGAAGCAGCATGG + Intronic
918133422 1:181648127-181648149 AAATCTCCACAGATTGAGAGGGG + Intronic
920925204 1:210334589-210334611 TATTACCCACAGAAGGAGCAGGG - Intronic
921124735 1:212167344-212167366 GAATATCCACAGAGGGATGAAGG - Intergenic
921220627 1:212971186-212971208 AAATATCCATCGATGGATAAAGG - Intronic
921320392 1:213932855-213932877 AAAGATCCAAAGAAGGAGGATGG - Intergenic
921463830 1:215461658-215461680 ACATATCCCCTGATGGAGGAGGG - Intergenic
921527371 1:216234437-216234459 ACATATCCAGAAATAGAGCATGG + Intronic
922392382 1:225158328-225158350 GAAAATCCAGAGATGGGGCAGGG + Intronic
922607627 1:226900362-226900384 AATTGTCCACAGAGGGGGCAGGG - Intronic
924133530 1:240938187-240938209 AAAAATCCACAGATGTGGGAGGG - Intronic
1065571172 10:27072310-27072332 AAGAATCCACAGAAGGAGCTGGG - Intronic
1066163677 10:32762024-32762046 AAATATCCACATATTGGGTAGGG + Intronic
1067115464 10:43432468-43432490 AAAGAACCACAGATGTAGCCAGG - Intergenic
1067435806 10:46276178-46276200 AATTTTCCACAAATGGAGCTGGG - Intergenic
1067735995 10:48851294-48851316 AAGCATCCACATATGGAGGAGGG - Intronic
1067747148 10:48944387-48944409 AAAACTCCACAGCTGGACCAGGG + Intronic
1070063350 10:73008071-73008093 AATTGTCCACAGATGAAACATGG + Exonic
1072195058 10:93110386-93110408 AAATCTGCACAGATGCAGCCAGG - Intergenic
1072780550 10:98248399-98248421 AAATAACAACAGATGAAGAAAGG + Exonic
1074587476 10:114782394-114782416 AACTACCCACAGAAAGAGCAAGG + Intergenic
1074670509 10:115785125-115785147 ACATATCCACCGATGGAGAGGGG - Intronic
1075456377 10:122587650-122587672 AAACACCCCCAGATGCAGCAGGG + Intronic
1076140615 10:128076178-128076200 AAATACACCCAGATGGAGTAAGG - Intronic
1076910884 10:133388762-133388784 AAGGAACCACTGATGGAGCAGGG - Intronic
1076925931 10:133487016-133487038 AAATAATAACAGATGAAGCAAGG - Intergenic
1077616171 11:3675700-3675722 AACTATCCACAGAAGGAAGAGGG - Exonic
1080792121 11:35530751-35530773 AAAGATCCCCATATGGATCAAGG + Intergenic
1081603966 11:44515228-44515250 AAATGTCCCCAGCTGGGGCAAGG + Intergenic
1084680845 11:70665433-70665455 GAAAATTCTCAGATGGAGCAGGG - Intronic
1087788574 11:102383468-102383490 AAATATGCAAAGTTGGAGAATGG + Intergenic
1088246653 11:107825014-107825036 AAATAGCCATATATGGAGAATGG + Intronic
1088552524 11:111027417-111027439 AATTATCCAGAGCTGAAGCAAGG + Intergenic
1090307118 11:125701045-125701067 AAAAAACCACAGATGGATCATGG + Intergenic
1091024510 11:132130113-132130135 AAATATTCTCAGAAGGAGAAGGG + Intronic
1091792106 12:3277852-3277874 AATTTCCCACAGATGGAGAAAGG - Intronic
1092510976 12:9156359-9156381 CAAGATCCAGAGATGGAGGAAGG - Intronic
1094708519 12:32938106-32938128 AAATATCTACAGCTGCAGAATGG + Intergenic
1095573945 12:43713410-43713432 AAATGTCCACAAAAGGAACATGG - Intergenic
1099837392 12:87924038-87924060 AAGTATCTACAGATATAGCAAGG + Intergenic
1100140693 12:91615297-91615319 ATATATCAACATATGGAACATGG - Intergenic
1100354758 12:93818624-93818646 AAATATCTGCAGAGGGGGCAAGG + Intronic
1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG + Intronic
1104709535 12:130975939-130975961 AAACATTCACAGAGGGAGGAAGG - Intronic
1106635696 13:31526205-31526227 AAATATCCACAAATGTGGCAGGG - Intergenic
1108273299 13:48783858-48783880 AAATATCCACAAAAGGAGCAAGG + Intergenic
1108485346 13:50917946-50917968 AAACATACTGAGATGGAGCATGG - Intronic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1108935893 13:55879381-55879403 AAATAGCCAGAGATGGATAAAGG - Intergenic
1110698835 13:78523433-78523455 GAATATTCACTGATGGACCAAGG - Intergenic
1110786237 13:79530410-79530432 AAATTGCCACAGCTGGAGCTGGG - Intronic
1111413376 13:87906918-87906940 AAATATCCATAGTTTAAGCAGGG + Intergenic
1111640097 13:90957776-90957798 AAATATCTACAAATAGAGCAAGG + Intergenic
1111861636 13:93714730-93714752 GCTTCTCCACAGATGGAGCAAGG + Intronic
1112491870 13:99873078-99873100 AAACCTCCACAAATGGGGCAGGG - Intronic
1113594878 13:111524060-111524082 AAGTAGCCACAGATGAAGCTAGG - Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114376672 14:22153746-22153768 AAATAAGCACATATGGAGAATGG - Intergenic
1114576606 14:23719989-23720011 ATTTTTCCACAGATGGAGCAGGG - Intergenic
1115028847 14:28771074-28771096 AAATATACACAAATGGGGAATGG + Intergenic
1119933193 14:78567426-78567448 GAAGATCCAGAGATGGAGCAGGG - Intronic
1120064669 14:80027146-80027168 AAATATGCACAAATAGACCAAGG + Intergenic
1123184947 14:106507680-106507702 AAATGTTCATAAATGGAGCAGGG - Intergenic
1124811451 15:32943195-32943217 AAATATCCACATAGGGTACACGG + Intronic
1126463936 15:48943491-48943513 AAGTATCCACTGATGGATAAAGG - Intronic
1129025264 15:72566239-72566261 AAAAATGCACTGATGAAGCATGG + Intronic
1132765524 16:1532453-1532475 GTATATCCACAGGTGAAGCAAGG - Intronic
1134630790 16:15754505-15754527 AAAAATCCACTGATGAAGTAGGG + Intronic
1138107590 16:54297539-54297561 AAATATCAGCAGAAGTAGCATGG - Intergenic
1138133075 16:54498833-54498855 ATAAATCCTCAGATGGTGCAAGG + Intergenic
1141780866 16:86159866-86159888 AAATATCCATAGCTTGAGCTAGG - Intergenic
1142585279 17:968410-968432 AAAGATACACAGATGCAGCCCGG + Intronic
1143167295 17:4903196-4903218 AAATGTCCCCAGCTGCAGCAGGG - Intergenic
1143385553 17:6527992-6528014 CAAAAGCCAAAGATGGAGCAGGG - Intronic
1143662900 17:8338038-8338060 AAATGCTCACTGATGGAGCAGGG - Intergenic
1144301577 17:13926377-13926399 AGATTTCCTCAGTTGGAGCACGG - Intergenic
1146567862 17:33928767-33928789 GCAGATCCACAGATGGAGGAGGG + Intronic
1148000584 17:44385044-44385066 AAATATCCGCAACTGGAGCCTGG + Exonic
1150753686 17:67890465-67890487 TAAAATCCAGAGATGGAGAAGGG - Intronic
1153311898 18:3685264-3685286 AAAAATCCAAAGATGGGGCCTGG + Intronic
1153828766 18:8901052-8901074 AAATACCATCAGATGGGGCAGGG - Intergenic
1154086922 18:11314454-11314476 AAATACTCAGAGATGGAGAAGGG + Intergenic
1154199480 18:12289348-12289370 AAAGATCCAGAGATGGGGAAGGG + Intergenic
1156692608 18:39726539-39726561 ATAGAGCCACAGAAGGAGCAGGG - Intergenic
1159084047 18:63767411-63767433 AAATATCAACAGATTGATCTGGG - Intronic
1160625105 18:80198735-80198757 AAGTATTCACATATGGAGAATGG + Intronic
925061985 2:898409-898431 AAATATCTAGAAAAGGAGCAGGG + Intergenic
925648945 2:6068360-6068382 GATTATGCACAGAGGGAGCAGGG - Intergenic
926666665 2:15531899-15531921 AAATAATCAGAGATGGAGAATGG - Intronic
927185618 2:20480045-20480067 AGTTATCCCCAGCTGGAGCATGG - Intergenic
929573460 2:43038195-43038217 AAATGTCCAAAAATGGGGCATGG - Intergenic
930350028 2:50239551-50239573 AAATTTCCTCAGATATAGCATGG - Intronic
932971513 2:76548926-76548948 AAATGTCCACAGTTGGAGACAGG + Intergenic
933056998 2:77683133-77683155 ATTTTTCCACAGATGGGGCACGG + Intergenic
933927130 2:87104276-87104298 ATTTTTCCACAGATGGGGCACGG + Intergenic
935554720 2:104496762-104496784 AAATAGACACAGATAGAGAAGGG - Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936869185 2:117112393-117112415 CAATATCCAAAGCAGGAGCATGG - Intergenic
938232359 2:129672212-129672234 CAATATCCAATGATGGAACAGGG - Intergenic
938928635 2:136066747-136066769 CAAGATTCACAGATGGAGGATGG + Intergenic
940406638 2:153311346-153311368 AAATATCCAAATATGAAGAAAGG + Intergenic
940449434 2:153818783-153818805 TAAAATGCTCAGATGGAGCAGGG - Intergenic
940948463 2:159645381-159645403 ATTTTCCCACAGATGGAGCAAGG + Intergenic
943324312 2:186479816-186479838 AAAAATCCCCAGATGTATCAGGG + Intergenic
944498202 2:200329722-200329744 AAAGATCCACAGACGTGGCAAGG - Intronic
944691097 2:202159191-202159213 CATCATCCAAAGATGGAGCAGGG + Intronic
945344651 2:208698877-208698899 AAACATGCACAGATGAAGCAAGG - Intronic
946942473 2:224784114-224784136 AAGTCTCCAGAGATGGAGAAAGG - Intronic
1169930781 20:10830636-10830658 AAATATCCATACATGGATGAAGG + Intergenic
1170169689 20:13396707-13396729 AAATATCAACAGAATGAGAAAGG + Intronic
1172876367 20:38166721-38166743 AAATATCCACTGAAGCAACACGG - Intergenic
1173022597 20:39279663-39279685 ATAAATAAACAGATGGAGCATGG + Intergenic
1173392368 20:42646527-42646549 AAATATCCACATATGGCCAATGG - Intronic
1177926630 21:27224139-27224161 AAATAAGCACAGATGTAACAAGG + Intergenic
1178730065 21:35093669-35093691 GGATGTCCCCAGATGGAGCAGGG - Intronic
1180651079 22:17377693-17377715 AAATATGCAAATATGGAGGAAGG - Intronic
1181575223 22:23789899-23789921 ACAGCTCCACAGATGGCGCATGG - Intronic
1182341616 22:29626445-29626467 AAATATCTGCAGATGGGGCTGGG - Intronic
1183705582 22:39473340-39473362 AAGTATCCACACATGGAGACGGG + Intronic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
1184945189 22:47797601-47797623 AATTATTTAAAGATGGAGCAGGG + Intergenic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
950238430 3:11344942-11344964 AAATATACAAAGATAGAACAAGG - Intronic
950575606 3:13830403-13830425 AAACATGAACAGATGGGGCATGG - Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953477518 3:43218229-43218251 CAATAACCCCAGATAGAGCATGG - Intergenic
955130989 3:56168340-56168362 TAATAGCCACAAAAGGAGCAGGG + Intronic
955765339 3:62338553-62338575 AAATATCCAGAGATGGATGGTGG + Intergenic
956503356 3:69910845-69910867 AAAAATCCACAGAAGGGACAAGG - Intronic
957243054 3:77683912-77683934 AACGATCAACAGATGGAGGAAGG + Intergenic
957369037 3:79267063-79267085 AAATATCCACATATGGATAGTGG - Intronic
957511758 3:81198271-81198293 AAATATCCACAAAGGGAGCTTGG + Intergenic
958076138 3:88681115-88681137 ATATATCTAGAGATGAAGCAAGG + Intergenic
958634125 3:96721000-96721022 AAATCTTCAGAGATGGAGAAAGG + Intergenic
960343981 3:116509796-116509818 ATATAGCCACTGATGGAGCTTGG + Intronic
961794598 3:129400756-129400778 GAATAGCCACAGATGCAGCAGGG - Intergenic
961839729 3:129698999-129699021 AACTATCCAGATATGTAGCAGGG + Intronic
962143325 3:132813515-132813537 AAATATCCTACAATGGAGCATGG - Intergenic
962993469 3:140601700-140601722 AAATAATGACAGATGGGGCAGGG - Intergenic
963766809 3:149345348-149345370 AAATATCTACTTATGGAGGAGGG - Intergenic
964659950 3:159109257-159109279 AAATTACCACAGTTGGAGAAAGG - Intronic
966651069 3:182301683-182301705 AATTATCCAGAGATGTTGCAAGG - Intergenic
968001031 3:195206944-195206966 AAATATCCACAGAAGGAGAGAGG - Intronic
968155047 3:196373924-196373946 AAATATCCTCATATTGAGCCAGG + Intronic
969617487 4:8262176-8262198 AGAGACCCACAGATGGGGCAGGG + Intergenic
970642508 4:18082770-18082792 AAATCTCAACAGATGGAGACAGG - Intergenic
970779270 4:19716255-19716277 AACCTTTCACAGATGGAGCAGGG - Intergenic
972755171 4:42039245-42039267 AAATATACAGAGAATGAGCATGG - Intronic
974217400 4:58867830-58867852 AAATATCCATAGATTGCTCAAGG + Intergenic
974436864 4:61867789-61867811 AAATATGCACAGTTTGAGGATGG - Intronic
976214732 4:82705313-82705335 AAATATCCTCAGAGGCAGCTTGG + Exonic
977480955 4:97574736-97574758 AAAAATCCACAGAAGCAGAAAGG - Intronic
979180900 4:117725995-117726017 AACTACCCACAGATGTACCAAGG + Intergenic
980734242 4:136863911-136863933 AAATAGCCACAGAGGGAGCTTGG + Intergenic
982850622 4:160310828-160310850 AAATAAACACAGCTGGAGAAAGG - Intergenic
984609289 4:181819594-181819616 AATTTTCCACAGATGGAGGGTGG + Intergenic
985983773 5:3495526-3495548 AAATATTCACAGATGAGACAAGG - Intergenic
989017952 5:36962253-36962275 ACACATCCACAGATGCAACAAGG + Exonic
989982838 5:50664630-50664652 AAATATTCGGAGATGGGGCAAGG + Intergenic
990869148 5:60412396-60412418 AAATACCTCCAGATGGAGTAAGG - Intronic
991066235 5:62427759-62427781 ATTTTTCCACAGATGGGGCAGGG - Intronic
992833066 5:80614418-80614440 GAATATGGAGAGATGGAGCAAGG - Intergenic
993161672 5:84299256-84299278 TAATATCGAAAGAAGGAGCATGG + Intronic
993492728 5:88571432-88571454 AAATATCCATAGGTGGAGAAGGG + Intergenic
995404874 5:111783600-111783622 AAACTTCCTCAGATGGAGAAGGG - Intronic
996848931 5:127931492-127931514 CAATATGCACAGCTGGAGGAGGG - Intergenic
997860513 5:137411285-137411307 AATTATCCACAGAATGAGGACGG + Intronic
1003860598 6:10319026-10319048 AAATGTCCACAGCTGGGGCATGG + Intergenic
1003948456 6:11096178-11096200 ATTTTTCCACAGACGGAGCAGGG + Intronic
1004620879 6:17329261-17329283 AAATAACCACAGGTCGGGCATGG - Intergenic
1005527498 6:26665321-26665343 AATTTTCCACAGATGGTGGAGGG - Intergenic
1006150212 6:31983049-31983071 CAAACTCCACAGAGGGAGCAGGG - Intronic
1006156513 6:32015787-32015809 CAAACTCCACAGAGGGAGCAGGG - Intronic
1007691961 6:43708221-43708243 AAAGACCCAGGGATGGAGCAGGG + Intergenic
1007729997 6:43939836-43939858 AAATTTCCTCAGAGGGGGCAGGG - Intergenic
1010055975 6:71564029-71564051 AAATAGCCATAGACTGAGCACGG + Intergenic
1010261994 6:73827950-73827972 AAAGATCTACAAATGGAACATGG - Exonic
1011996750 6:93599332-93599354 AAATTTCCAGTGTTGGAGCAGGG + Intergenic
1014758177 6:125325030-125325052 AAATCTCCACGGGTGAAGCAAGG + Intergenic
1015968743 6:138722101-138722123 AAATACCCACAGATGGATATTGG - Intergenic
1016693777 6:146968814-146968836 AAATAGCCACAGTTTGAGAATGG + Intergenic
1017191277 6:151655398-151655420 AAATATCCACAGAGTGACAAAGG + Intergenic
1017596423 6:156033974-156033996 AAAAATCCACAGATCCAGGAAGG - Intergenic
1017612304 6:156201566-156201588 AAACATCCACTGATGGATAAAGG + Intergenic
1019267665 7:127458-127480 CAACATCCACAGATTCAGCAGGG - Intergenic
1020506821 7:9000955-9000977 AAAAATACACAAATGGAGAAAGG + Intergenic
1021577750 7:22119841-22119863 GAATATCCAGAGAGGGTGCATGG + Exonic
1022463059 7:30630212-30630234 AAATATCACAAGATGGAGGAAGG + Intronic
1022671422 7:32459803-32459825 GAATATCCAAAGATGCAGCTGGG + Intergenic
1023165664 7:37341160-37341182 AAAGCTCCACAGATTGAGAAGGG + Intronic
1024590811 7:50881256-50881278 AAATCTGCACAGATGGTTCATGG - Intergenic
1028922440 7:96322413-96322435 AAGTAACGACAGATGGTGCACGG + Intergenic
1029353466 7:100032415-100032437 AAATGACAACAGAGGGAGCATGG - Intronic
1030733898 7:113021267-113021289 AAATAAGCACATATGGAGAATGG + Intergenic
1030811376 7:113976374-113976396 AAATAAGCACAGATGGAGAGTGG - Intronic
1031293303 7:119967235-119967257 AAATATCCAGGGTTGGAGAAGGG + Intergenic
1034130696 7:148714013-148714035 AAATATACACACATGCAGCCAGG - Intronic
1035612918 8:980249-980271 AAATATCCATAGAAGGTGCAGGG + Intergenic
1036952146 8:13150996-13151018 AGATGTCTACAGATGGAACAGGG + Intronic
1037549079 8:19952151-19952173 AAATATCAAACGATAGAGCAGGG - Intronic
1040120583 8:43680568-43680590 AAATATCCCCAGATAGAAAATGG + Intergenic
1043231178 8:77803317-77803339 GCTTATTCACAGATGGAGCACGG + Intergenic
1043815504 8:84796013-84796035 AAGTAGCCACAGCTGGAGAAGGG + Intronic
1047513115 8:125530537-125530559 AAATGTTCTCAGATGGATCATGG - Intergenic
1050119238 9:2291282-2291304 ATATATCCACAGAGGGAAAAGGG - Intergenic
1052104217 9:24492409-24492431 CAAAATCCAAAGATGGAGCGAGG + Intergenic
1052771337 9:32693738-32693760 AAATAAGCACACATGGAGAATGG - Intergenic
1055638317 9:78298524-78298546 ACATCTCCACAGCTGGAGCAGGG - Intronic
1056052492 9:82784042-82784064 AAAAAGCGACAGAGGGAGCACGG - Intergenic
1059168682 9:112103911-112103933 AAATGGCTCCAGATGGAGCATGG - Intronic
1059393724 9:114017465-114017487 AAATATCCAGAAAAGGAGCTGGG - Intronic
1061176185 9:128998782-128998804 GGATATCCTGAGATGGAGCAGGG + Intronic
1193712592 X:84896277-84896299 AAAGATCCATAGAAGAAGCATGG + Intergenic
1195907386 X:109858269-109858291 AAATATGCAGAGATAGAACAAGG - Intergenic
1196093789 X:111776569-111776591 AGATATTCTCAGATGGAGAAAGG - Exonic
1199159222 X:144587602-144587624 AAGAATCCACACAGGGAGCAGGG + Intergenic
1199208138 X:145173671-145173693 AAAAGTCCTCAGATGGAGCAAGG + Intergenic
1200412025 Y:2870330-2870352 AAAAATCCAAAAATGGAGCCAGG + Intronic
1201190992 Y:11441452-11441474 GAAGATCCAGAGAAGGAGCAGGG - Intergenic