ID: 953259335

View in Genome Browser
Species Human (GRCh38)
Location 3:41322394-41322416
Sequence AAATTTGTCTGAGGGGCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 806
Summary {0: 1, 1: 7, 2: 102, 3: 182, 4: 514}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953259335_953259342 19 Left 953259335 3:41322394-41322416 CCTTATGCCCCTCAGACAAATTT 0: 1
1: 7
2: 102
3: 182
4: 514
Right 953259342 3:41322436-41322458 GAGGTTGCTGTAGACCCGTATGG 0: 2
1: 38
2: 157
3: 239
4: 286
953259335_953259341 0 Left 953259335 3:41322394-41322416 CCTTATGCCCCTCAGACAAATTT 0: 1
1: 7
2: 102
3: 182
4: 514
Right 953259341 3:41322417-41322439 TTCTGAGGAGGCAATAATTGAGG 0: 9
1: 264
2: 368
3: 270
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953259335 Original CRISPR AAATTTGTCTGAGGGGCATA AGG (reversed) Intronic
900753039 1:4411755-4411777 GAATTCGACTGAGGGGCATAAGG + Intergenic
901729202 1:11266582-11266604 GAATTCAACTGAGGGGCATAAGG + Intergenic
902120719 1:14163152-14163174 GAATTTATCTGAGGGGCATAAGG + Intergenic
902975001 1:20082051-20082073 GAATTCGACTGAGGGACATAAGG + Intronic
905048119 1:35024822-35024844 AAAATTGTGTGAGGTGCATTGGG - Intronic
905051895 1:35058918-35058940 GAATTCAACTGAGGGGCATAAGG - Intergenic
905610161 1:39343751-39343773 GAATTTGACCAAGGGGCATAAGG + Intronic
906831378 1:49035302-49035324 GAATTTGATTGAGGGGCATAAGG + Intronic
907079423 1:51607768-51607790 GAATTTGGCCAAGGGGCATATGG + Intronic
907111768 1:51933148-51933170 ATATTTGTATGAGGTACATATGG - Intronic
907278772 1:53331535-53331557 TAATTTCTGTGAGGGGCAAAGGG + Intergenic
907793579 1:57692193-57692215 AAGTTTGTCTGACAGGCATTAGG - Intronic
907842104 1:58168424-58168446 AAGTTTGTCTGACAGGCATTAGG - Intronic
908043993 1:60148464-60148486 ATATTTGTCTGAAGGTCTTAGGG + Intergenic
908281558 1:62542474-62542496 AATTTTGTCTTAGAGGCACATGG + Intronic
908660109 1:66426001-66426023 AATTTTGTCTGACAGGCATTAGG + Intergenic
908948087 1:69524283-69524305 GAATTTGACTGAGGAGCACATGG + Intergenic
909084369 1:71154299-71154321 GAATTTGACTGAGGAGCATAAGG - Intergenic
909100499 1:71342593-71342615 GAATTTGACTGAGGGGCATAAGG + Intergenic
909201426 1:72694197-72694219 GAACTTGGCTAAGGGGCATAAGG + Intergenic
909713054 1:78673894-78673916 GAGTTTAACTGAGGGGCATAAGG + Intergenic
910024069 1:82627993-82628015 GAATTCGACAGAGGGGCATAAGG + Intergenic
910365398 1:86459878-86459900 GAATTTGACCGAGGGGCATAAGG + Intergenic
910956124 1:92707238-92707260 AAATTTGTTTGCAGGACATAAGG + Intronic
911130019 1:94377916-94377938 AAGTTTGTCTGACAGGCATTAGG + Intergenic
911159284 1:94668268-94668290 GAATTCGTCTGAGGGGCATAAGG - Intergenic
911238560 1:95438940-95438962 AAATTTGAATAAGGGCCATAGGG - Intergenic
912187168 1:107292274-107292296 AAATTCGACTGAGGGGCATAAGG + Intronic
912187259 1:107292978-107293000 GAATTCATCTGAAGGGCATAAGG - Intronic
912237337 1:107866255-107866277 GAATTCGACTGAGGGGCATAAGG - Intronic
912626977 1:111213417-111213439 GATTTTGACTGAGGGGAATAAGG + Intronic
913204665 1:116526354-116526376 AAAATTTTGTGAAGGGCATAAGG + Intronic
913367067 1:118050386-118050408 GAATTCAACTGAGGGGCATAAGG - Intronic
913524531 1:119678385-119678407 GAATTCAACTGAGGGGCATAAGG + Intronic
914318820 1:146539898-146539920 GAATTTGACTGAGGGGCATAAGG + Intergenic
914495538 1:148193459-148193481 GAATTTGACTGAGGGGCATAAGG - Intergenic
916036334 1:160925886-160925908 AAAATCAACTGAGGGGCATAAGG - Intergenic
916083374 1:161251036-161251058 AAGTTTGTCTGACAGGCATTAGG - Intergenic
916706513 1:167356631-167356653 GAATTCGACTGAGGGGCATAAGG + Intronic
916816905 1:168362990-168363012 AAAATTGACTGAGGGACATAAGG - Intergenic
917227329 1:172799220-172799242 AAGTTTGTCTGACAGGCATTAGG - Intergenic
917279652 1:173368809-173368831 AAGTTTGTCTGACAGGCATCAGG - Intergenic
917353793 1:174105400-174105422 GAATTCAACTGAGGGGCATAAGG + Intergenic
917540655 1:175910565-175910587 GAATTTGACTCAAGGGCATAAGG + Intergenic
917567364 1:176226527-176226549 GAATTAGACTGCGGGGCATAAGG - Intergenic
917676032 1:177320524-177320546 AAGTTTGTCTGACAGGCATTAGG - Intergenic
918324548 1:183396831-183396853 GAACTCGACTGAGGGGCATAAGG - Intronic
918403439 1:184187915-184187937 GAATTTGACTAAGGGGCCTAAGG - Intergenic
918687386 1:187435255-187435277 AAATGTCTCTGAAGGGCATGAGG - Intergenic
918788884 1:188800042-188800064 GAATTTGACTAAGGTGCATAGGG + Intergenic
919298522 1:195732806-195732828 GAATTCGACTGAGGGGCACAAGG - Intergenic
921019470 1:211223172-211223194 AAGTTTGTCTGACAGGCATTAGG - Intergenic
921294846 1:213692036-213692058 GAATTTGACTGAAGGACATAAGG + Intergenic
922663445 1:227449445-227449467 GAATTTGACTGACGGGCAGAAGG + Intergenic
922875396 1:228936425-228936447 AAATTCGACTGAGGGGCATAAGG - Intergenic
924298275 1:242611168-242611190 GAATTTGACTGAGGGGCAGAAGG + Intergenic
924601743 1:245496266-245496288 GAATCTGGATGAGGGGCATATGG + Intronic
1062947608 10:1473256-1473278 GAATTCGCCTGAGGGGCATAAGG - Intronic
1062986506 10:1773913-1773935 GAATTTGGCCAAGGGGCATAAGG - Intergenic
1063786579 10:9391917-9391939 GAATTTGACTGAGGGGCATAAGG + Intergenic
1063859313 10:10290739-10290761 AAATTTGTCTGACAGACATTAGG + Intergenic
1064405087 10:15054403-15054425 GAATTTGACCAAGGGGCATAAGG - Intronic
1064603787 10:17017858-17017880 AAATTTGTCTGACAGGCATTAGG + Intronic
1064644397 10:17446070-17446092 AGATTTGTTTAAGGGGTATATGG + Intronic
1065209608 10:23390133-23390155 GAATTTGACTAAGGGGCATAAGG + Intergenic
1065309269 10:24398474-24398496 CAATTTGACTGAGGGGCCTAAGG + Intronic
1065506504 10:26435101-26435123 GAATTCAACTGAGGGGCATAAGG - Intergenic
1065534839 10:26706866-26706888 GAATTCGACTGAGGGGCCTAAGG + Intronic
1065640349 10:27776064-27776086 GAATGCGACTGAGGGGCATAAGG + Intergenic
1066084420 10:31962478-31962500 GGATTTGACTGAGGGGCAGAAGG + Intergenic
1066289263 10:33998941-33998963 GAATTCGACTGAGGGGCATAGGG + Intergenic
1067893936 10:50159860-50159882 GAATTTGACGGAGGGGCATAAGG - Intergenic
1067954909 10:50780404-50780426 GAATTTGACTGAGGGGCATAAGG + Intronic
1068191989 10:53664622-53664644 GAATTTGACTGAGGGGCATAGGG + Intergenic
1068240428 10:54296461-54296483 AAGTTTGTCTGACAGGCATGAGG - Intronic
1068438520 10:57020933-57020955 GAATTTGACTGAGGGGCATAAGG - Intergenic
1068497103 10:57796394-57796416 GAATTTGACTGAGGGGCATAAGG - Intergenic
1068500090 10:57833589-57833611 AAGTTTGTCTGATAGGCATTAGG - Intergenic
1069107136 10:64397093-64397115 GAATTTGACTCAGGGGCATAAGG + Intergenic
1069174318 10:65271335-65271357 GAATTCGACTGAGGGGCATAAGG + Intergenic
1069330288 10:67283766-67283788 GAATTTGACCGAGGGGCATAAGG - Intronic
1069365304 10:67689522-67689544 AAGTTTGTCTGACAGGCATTAGG + Intronic
1070744327 10:78923759-78923781 AAATCTGTCTGATGGGCAGAAGG - Intergenic
1072445840 10:95497778-95497800 AAATATGACTGTGGGGCAGAGGG - Intronic
1072531194 10:96321140-96321162 GAATTCGACTGGGGGGCATAAGG + Intronic
1073932085 10:108587461-108587483 GAATTCTACTGAGGGGCATAAGG - Intergenic
1073970527 10:109042181-109042203 AAGTTTGTCTGACAGGCATTAGG - Intergenic
1074002690 10:109388355-109388377 GAATTTGACTGAGGGGCATAAGG - Intergenic
1074338424 10:112601814-112601836 TAATTTTTCTGAAGGGCATTGGG + Intronic
1074742855 10:116501433-116501455 AAGTTTGTCTGACAGGCATTAGG + Intergenic
1075377356 10:121989391-121989413 AAATTCGCCCAAGGGGCATAAGG - Exonic
1075618986 10:123911898-123911920 GAATTCGACTGAGGGGCATAAGG + Intronic
1076429941 10:130394811-130394833 GAATTCCACTGAGGGGCATAAGG - Intergenic
1076480285 10:130780354-130780376 GAATTCGTCCGAGGGGAATAAGG - Intergenic
1077753731 11:5003042-5003064 GAAATTGACTGAGGGGCATAAGG + Intergenic
1077839181 11:5955434-5955456 GAATTCAGCTGAGGGGCATAAGG + Intergenic
1078281265 11:9903517-9903539 GAATTGGACTGAGGGGCATAAGG + Intronic
1078633041 11:13022196-13022218 ACATTTTTCTCAGGTGCATATGG - Intergenic
1078819314 11:14861678-14861700 GAATTCAACTGAGGGGCATAAGG + Intronic
1079471926 11:20786643-20786665 AAATTTATCTGAGGGGCATAAGG + Intronic
1079557781 11:21782392-21782414 GAATTCGACTGAGGGGTATAAGG + Intergenic
1079682853 11:23320503-23320525 AGAATTCTATGAGGGGCATAAGG - Intergenic
1079811871 11:25006273-25006295 AAGTTTGTCTGACAGGCATTAGG + Intronic
1081159021 11:39731300-39731322 GAATTTGACTGAGGGGCATAAGG + Intergenic
1081234591 11:40632129-40632151 AATATTTTTTGAGGGGCATAAGG - Intronic
1081253960 11:40869918-40869940 GAATTAGACTGAGGGGCCTAAGG - Intronic
1081305015 11:41501437-41501459 GAATTTGGCTGAGGGGCAGAAGG + Intergenic
1081421189 11:42875868-42875890 AAATTTGTCTGGCAGGCATTAGG - Intergenic
1082803729 11:57433084-57433106 AAAATTGCCTCAGGGGCATCAGG + Intergenic
1082942725 11:58725601-58725623 GAATTTGACTGAGGGGCAGAAGG + Intronic
1082943078 11:58728419-58728441 GAATTCAACTGAGGGGCATAAGG - Intronic
1082944823 11:58747104-58747126 ACCTTTGTCTGTGGGGCAAATGG - Intergenic
1084375511 11:68774224-68774246 GAATTTGACTGTGGGGCAGAAGG - Intronic
1084988310 11:72897837-72897859 GAATTTTTCTGAGGAGGATATGG - Intronic
1085622007 11:78044674-78044696 GAATTAGTCGGAGGGGCATAAGG + Intronic
1086533156 11:87810893-87810915 GAATTCAGCTGAGGGGCATAAGG + Intergenic
1086791813 11:91048989-91049011 AAATTCAATTGAGGGGCATACGG - Intergenic
1087074796 11:94119163-94119185 AAGTTTGTCTGACAGGCATTAGG - Intergenic
1087308470 11:96511982-96512004 AAATCTGTATGAATGGCATATGG - Intergenic
1087459216 11:98424101-98424123 AAGTTTGTCTGACAGGCATTAGG + Intergenic
1087797507 11:102470075-102470097 GAATTTGACTGAGGGGCATAAGG - Intronic
1088234402 11:107707153-107707175 AAACTAGTCTGAAGGGCAGAGGG - Intergenic
1088492334 11:110400374-110400396 AAGTTTGTCTGACAGGCATTAGG - Intergenic
1089055593 11:115582367-115582389 GAATTTGACCAAGGGGCATAAGG + Intergenic
1089298432 11:117483380-117483402 AACTTTGACTGAGGGGCATCAGG + Intronic
1090980236 11:131713765-131713787 GACTTAGACTGAGGGGCATAAGG + Intronic
1091099457 11:132856990-132857012 AAATTCATCCAAGGGGCATAAGG - Intronic
1091294813 11:134466283-134466305 GAATTTGTGTGAAGAGCATAAGG + Intergenic
1091757940 12:3067508-3067530 CAATTCGACTGAGGGGCATAAGG - Intergenic
1092575112 12:9774410-9774432 GAATTTGACCAAGGGGCATAAGG + Intergenic
1092683492 12:11015460-11015482 GAATTCAACTGAGGGGCATAAGG - Intronic
1092761581 12:11815786-11815808 AAATTCGTTTGACGGGCAGAGGG + Intronic
1093653275 12:21668535-21668557 GAATTTGACTGAGGGTCACAAGG + Intronic
1093946518 12:25116011-25116033 AAAGTTGTAGGAGGGGCAGATGG - Intronic
1094338336 12:29384860-29384882 AAGTTTGTCTGACAGGCATTAGG + Intergenic
1094481723 12:30888472-30888494 AAATTTGGCTGGAGGGTATATGG + Intergenic
1095211546 12:39500593-39500615 GAATTAGACTGAGGGGCACAAGG + Intergenic
1095314748 12:40746424-40746446 GAATTTGACTGAGGGGCATAAGG + Intronic
1095328745 12:40931333-40931355 AAATTTGTCAGAGAGGCAGAAGG - Intronic
1096130998 12:49158913-49158935 GAATTCCACTGAGGGGCATAAGG + Intergenic
1097133357 12:56830768-56830790 GAATTAGACTGAGGGTCATAAGG + Intergenic
1097134147 12:56837341-56837363 GAATTTGACTGAGGGGCATAAGG + Intergenic
1097428104 12:59471921-59471943 AAGTTTGTCTGACAGGCATTAGG - Intergenic
1097451469 12:59741898-59741920 TAATTTGACTGAGGGGCATAAGG + Intronic
1097931566 12:65193161-65193183 GAATTCGACTGAGAGGCATAAGG + Intronic
1098055763 12:66503576-66503598 GAATTCAACTGAGGGGCATAAGG - Intronic
1099102368 12:78458833-78458855 GAATTTGACTGTGGGGCATAAGG + Intergenic
1099414961 12:82373558-82373580 AAGTTTGTCTGACAGGCATTAGG + Intronic
1099437430 12:82660578-82660600 GAATTCAACTGAGGGGCATAAGG + Intergenic
1099577089 12:84394714-84394736 AAGTTTGTCTGACAGGCATTAGG + Intergenic
1099687805 12:85911396-85911418 TAATTTAACTGAGGGGCATAAGG - Intergenic
1099840920 12:87965878-87965900 AAAATAATCTGAGAGGCATAGGG - Intergenic
1100050976 12:90447393-90447415 AAGTTTGTCTGACAGGCATTAGG + Intergenic
1100135791 12:91551965-91551987 TAATTTGACTGAGGGGCGTAAGG + Intergenic
1100135956 12:91553572-91553594 GAATTCGGCTGAGGGGCATAAGG - Intergenic
1100277317 12:93082823-93082845 AAATTGGTCTGTGGGGAAAAAGG + Intergenic
1100530522 12:95457387-95457409 AAGTTTGTCTGACAGGCATTAGG + Intergenic
1100569969 12:95838099-95838121 CAATTTGACTGAGGGGCAGAAGG + Intergenic
1100758408 12:97777676-97777698 TAATTTGTCTCAGGGGCATAAGG - Intergenic
1101280827 12:103253737-103253759 GAATTTGACTGAGGGGCATAAGG - Intronic
1101296745 12:103431862-103431884 GAATTTAACTGAGGGGCATAAGG + Intronic
1101704662 12:107210830-107210852 AAGTTTGTCTGAGAGGCGTTAGG - Intergenic
1103126719 12:118429674-118429696 GAATTCGACTGAGGGGGATAAGG + Intergenic
1103169513 12:118803572-118803594 ACATTTGTCTCAAGTGCATATGG - Intergenic
1103554759 12:121759322-121759344 GAATTTGACTGAGGGGCATAAGG + Intronic
1104284409 12:127411758-127411780 GAATTTGCCCGAGGGGCATATGG + Intergenic
1104305968 12:127611211-127611233 AAGTTTGTCTGACAGGCATTAGG - Intergenic
1104683430 12:130768198-130768220 GAATTCGACTGAGGGGCATGAGG - Intergenic
1104766876 12:131335818-131335840 AAGTTTGTCTGACAGGCATTAGG - Intergenic
1105600023 13:21878504-21878526 CAGTGTGACTGAGGGGCATAGGG - Intergenic
1105696432 13:22893624-22893646 GAATTCAGCTGAGGGGCATAAGG - Intergenic
1106174051 13:27313490-27313512 TAATTTTTGTGAGTGGCATAAGG + Intergenic
1107122922 13:36814782-36814804 GAATTTGACCGAGGGGCCTAAGG - Intergenic
1108353076 13:49604957-49604979 GAACTTGACTGAGGGGCATAAGG - Intergenic
1108483047 13:50894756-50894778 GAATTTGGCTCAGGGGCATAAGG - Intergenic
1108702140 13:52952816-52952838 GAATTCGACTGAGAGGCATAAGG + Intergenic
1108718386 13:53105016-53105038 GAATTCAGCTGAGGGGCATAAGG + Intergenic
1108808331 13:54187263-54187285 TAATTTGATTGAGGGGAATAAGG - Intergenic
1109176830 13:59167467-59167489 GAATTTGACGGAGGGGCATAAGG + Intergenic
1109267410 13:60217224-60217246 GAATTCCACTGAGGGGCATAAGG + Intergenic
1109333849 13:60966973-60966995 AAAATCGACTGAGGAGCATAAGG - Intergenic
1109359939 13:61282635-61282657 GAATTTGACTGAGGGGTATAAGG + Intergenic
1109500821 13:63234770-63234792 AAGTTTGTCTGATAGGCATTAGG - Intergenic
1109738147 13:66514146-66514168 AAATATGTCTGAGTGAAATAAGG + Intronic
1110930695 13:81212328-81212350 GAATTTGTCCAAGGGGCATAAGG - Intergenic
1110937360 13:81307645-81307667 GAATTTGACTGAGGGGCATGAGG - Intergenic
1110952514 13:81514366-81514388 GAATTTGACTGAGGGTCCTAAGG - Intergenic
1110979170 13:81873598-81873620 AAATTCAACTGAGGGGCATAAGG - Intergenic
1111043143 13:82778163-82778185 AAATTCAACTGAGGGGCATGAGG + Intergenic
1111135399 13:84036167-84036189 GAATTCCACTGAGGGGCATAAGG + Intergenic
1111151157 13:84254856-84254878 GAATTTGACTGAGCGGCATAAGG - Intergenic
1111344119 13:86926330-86926352 GACTTTGACTGAGGAGCATAAGG + Intergenic
1111434127 13:88184235-88184257 GATTTTGACTGAGGGGCATAAGG - Intergenic
1111763493 13:92496899-92496921 GAATTCAACTGAGGGGCATAGGG + Intronic
1111798872 13:92958266-92958288 CAATTTGACTGAGGGGCATAAGG - Intergenic
1111934754 13:94547480-94547502 GAATTCGACTGAAGGGCATAAGG - Intergenic
1112019218 13:95357260-95357282 GAATTCATCTGAGGGGCATAAGG - Intergenic
1112170977 13:96971392-96971414 GAATTCAACTGAGGGGCATAAGG + Intergenic
1112247663 13:97749226-97749248 TAATTCGACTGAGGGTCATAAGG - Intergenic
1112654280 13:101433180-101433202 TAAGTTGTCTAAGGGGAATAAGG + Intergenic
1113204135 13:107896410-107896432 AAGTTTGTCTGACAGGCATTAGG + Intergenic
1114387433 14:22269618-22269640 GAATTTGACTGAGGGAAATAAGG - Intergenic
1114565367 14:23627983-23628005 GAATTCGACTGAGGGGCACAAGG - Intergenic
1114950174 14:27740773-27740795 ATATTTAATTGAGGGGCATAAGG + Intergenic
1115239346 14:31239585-31239607 GAATTCGACCGAGGGGCATAAGG + Intergenic
1115285683 14:31711042-31711064 AAGTTTGTCTGACAGGCATTAGG + Intronic
1115535428 14:34368576-34368598 AAATTTATGTGGAGGGCATATGG + Intronic
1115887956 14:37994633-37994655 GAATTTGACTGAGGGGCATAAGG - Intronic
1116064947 14:39970802-39970824 CAATTTGACCAAGGGGCATAAGG - Intergenic
1116173321 14:41430639-41430661 GAATTCGACTGAGGGGCATAAGG - Intergenic
1116276413 14:42839277-42839299 GAATTTGACTGAGGGGCATAAGG - Intergenic
1116341260 14:43726164-43726186 GAATTTGACTGAGGGGCATAAGG - Intergenic
1116479592 14:45382699-45382721 AAATTTGACTGATGGGCATAAGG + Intergenic
1116566175 14:46446942-46446964 GAATTCGACTGAGGGGCATAAGG - Intergenic
1116708584 14:48335571-48335593 AAATTTGACTGAGGGGCAGAAGG - Intergenic
1117099713 14:52333874-52333896 GAATTCGGCTGAGGGGCATAAGG + Intergenic
1117178363 14:53168348-53168370 GAATTGAACTGAGGGGCATAAGG + Intergenic
1117197250 14:53353036-53353058 GAATTCGACTGAGGAGCATAAGG - Intergenic
1118940818 14:70335341-70335363 AAATTTGTCTTAGGTCCATTTGG - Intronic
1119011273 14:70991659-70991681 AAATTTATCTGTGGGGAATTAGG + Intronic
1119064764 14:71514024-71514046 AAAATTGACTGAGGGGCATAAGG + Intronic
1119298443 14:73552160-73552182 GAATTTGACTGAGGGGCATAAGG - Intronic
1119302740 14:73584347-73584369 GAATTTGACTGAGGGGCATAAGG - Intergenic
1119596974 14:75944120-75944142 GAATTTGACTGAGGGGCATAAGG - Intronic
1119952316 14:78757826-78757848 AAAATTGGGTGAAGGGCATATGG + Intronic
1120376110 14:83709244-83709266 GAATTTGTCCAAGGGGCATAAGG - Intergenic
1120430004 14:84401649-84401671 TAATTCGACTGAGGGGCATCAGG - Intergenic
1120477591 14:85008044-85008066 TAATTTCACTGAGGGGCATAAGG + Intergenic
1120538152 14:85722407-85722429 GAATTTGACCAAGGGGCATAAGG - Intergenic
1120970000 14:90199276-90199298 GAATTTGACTGAGGGGCATAAGG - Intergenic
1121004278 14:90478452-90478474 GAATTTGACTGAGGGGCATAAGG + Intergenic
1121721465 14:96111773-96111795 ATATTCATCTGAGGGGCATAAGG + Intergenic
1121722278 14:96117817-96117839 AAATTCATCTGAGGGACATAAGG + Intergenic
1122144652 14:99682489-99682511 GAATTCGACTGAGGGGCGTAAGG - Intergenic
1122659599 14:103286430-103286452 AAATTCTTCTGATGGGCATTTGG - Intergenic
1122964487 14:105115742-105115764 GAATTTGACTGTGGGGCACAAGG + Intergenic
1123431009 15:20216337-20216359 GAATTCGACTGAGGGGCAGAAGG - Intergenic
1123778304 15:23601951-23601973 GAATTCGACTGAGGGGCATAAGG + Intronic
1125072733 15:35574895-35574917 AAATACTCCTGAGGGGCATATGG - Intergenic
1125355204 15:38810390-38810412 AAATTTCTCTGAGGTGCATATGG + Intergenic
1126061796 15:44789959-44789981 AAGTTTGTCTGAGTGGCAGTAGG - Intergenic
1126072271 15:44875470-44875492 AAGTTTGTCTGACAGGCATTAGG + Intergenic
1126184791 15:45821530-45821552 AAATTTGCCTTAGGGACATGTGG + Intergenic
1126594402 15:50370972-50370994 ACATTTTTTTGAGGGGCACAGGG - Intergenic
1126597011 15:50393049-50393071 GAATTTGACTGAGGGGCATAAGG - Intergenic
1127575122 15:60284463-60284485 GAATTTGTCTGAGGAGCATAAGG + Intergenic
1127943960 15:63730778-63730800 AAATTTGGCTGAAGAGCACAGGG + Intronic
1128849835 15:70943306-70943328 GAATTTGACTGAGGGGCATAAGG + Intronic
1130134542 15:81171431-81171453 AGAGATGTCTGATGGGCATATGG - Intronic
1130712901 15:86301295-86301317 AGATTGGGCTGAGGGACATAGGG + Intronic
1131010059 15:89009828-89009850 GGTTTTGACTGAGGGGCATAAGG - Intergenic
1131287128 15:91069577-91069599 GAATTTGACCGAGGGACATAAGG + Intergenic
1131661623 15:94523570-94523592 GAATTTGTCCAAGGGGCATAAGG + Intergenic
1132716099 16:1290546-1290568 AAATTCAGCTGAGGGGCAGAAGG + Intergenic
1135276843 16:21120550-21120572 AAAACAGTCTGAGGGGCTTAAGG + Intronic
1136853644 16:33634910-33634932 TAATTTGACTGAGGGGCAGAAGG + Intergenic
1137386925 16:48050397-48050419 GAATTTGTCTGAGGGGCATAAGG - Intergenic
1137746193 16:50821918-50821940 GAATTCAACTGAGGGGCATAAGG + Intergenic
1138201124 16:55089268-55089290 CATTTTGTTTGAGTGGCATATGG + Intergenic
1138522844 16:57581384-57581406 GAGTTTGACTGAGGGGTATAAGG + Intronic
1138748282 16:59389175-59389197 GAATTCGACTGAGGGGCATAAGG + Intergenic
1139042772 16:63017809-63017831 AAATTTGTATGAAGGACATTGGG + Intergenic
1140128057 16:72134216-72134238 GAATTTGACTGAGGGGCAGAAGG - Intronic
1140323643 16:73978469-73978491 GAATTTGTCCGAGGGGTGTAAGG - Intergenic
1203115235 16_KI270728v1_random:1483355-1483377 TAATTTGACTGAGGGGCAGAAGG + Intergenic
1144300589 17:13919892-13919914 GAATTTGACTGAGGGGCATAAGG - Intergenic
1145803910 17:27712845-27712867 AAGTTTGTCTGACAGGCATTAGG - Intergenic
1148348035 17:46917083-46917105 AAATTTGGCTGGGGGGCAGGGGG - Intergenic
1148956818 17:51361047-51361069 GAATTTGACTGAGGGGCATAAGG + Intergenic
1149223328 17:54440112-54440134 AAGTTTGTCTGACAGGCATTAGG - Intergenic
1149258126 17:54849985-54850007 GAATTCAACTGAGGGGCATAAGG - Intergenic
1149799562 17:59554769-59554791 TAATTCGACTGAGGGGCATAAGG + Intergenic
1150616470 17:66776256-66776278 GAATTTGACTGTGGGGCATCAGG + Intronic
1150827891 17:68492727-68492749 GAATTTGACTGAGGGGCATAAGG + Intergenic
1151051747 17:70985916-70985938 GAATTCAACTGAGGGGCATAAGG + Intergenic
1153101491 18:1475676-1475698 GAATTTGACCTAGGGGCATAAGG + Intergenic
1153218465 18:2842231-2842253 AAATTTATTTGGGGGGAATAAGG + Intergenic
1153437834 18:5086348-5086370 AAGTTTGTCTGACAGGCATTAGG - Intergenic
1153539353 18:6137076-6137098 GAGTTTGTCCCAGGGGCATAAGG - Intronic
1154044821 18:10894834-10894856 GAATCTGACTGAGGGGCACAAGG - Intronic
1154150669 18:11903966-11903988 TAATTCCACTGAGGGGCATAAGG - Intronic
1154363751 18:13687854-13687876 GAATTTGACTGATGGGCGTAAGG - Intronic
1155476970 18:26244817-26244839 AAGTTTGTCTGACAGGCATTAGG + Intronic
1156083867 18:33375876-33375898 TAATTTGACTGAGAAGCATAAGG + Intronic
1156084841 18:33385407-33385429 AAATTTTTCTCAGGGTCACATGG + Intronic
1156291233 18:35750225-35750247 GAATTTGACTGACGGGCATAAGG + Intergenic
1156634184 18:39008201-39008223 AAATTTGTCCAAGGGGAATAAGG + Intergenic
1156644293 18:39141144-39141166 TAATTTGACTGACGGGCATAAGG - Intergenic
1159054629 18:63451591-63451613 GAATTCGACTGAGGGGCATGAGG + Intergenic
1159324957 18:66902758-66902780 AAATTTGACTGAGGGGCATAAGG - Intergenic
1159539946 18:69761928-69761950 GAATTCTACTGAGGGGCATAAGG + Intronic
1159654423 18:71014792-71014814 GCATTTGACTGAGGGGCATAAGG - Intergenic
1159745671 18:72231972-72231994 GAATTCGACTGAGGGGCATATGG + Intergenic
1159892724 18:73967915-73967937 GAATTTAGCCGAGGGGCATAAGG + Intergenic
1160105111 18:75966384-75966406 GAATTTGACCAAGGGGCATAAGG - Intergenic
1162107692 19:8380360-8380382 AAGTTTGTCTGACAGGCATTAGG - Intronic
1163286978 19:16354903-16354925 TAAATTGTCTAAGGGGCTTATGG + Intergenic
1164087118 19:21913002-21913024 AAAATTGACTGAGGGGCTTAAGG + Intergenic
1164180075 19:22810597-22810619 AAACTCAACTGAGGGGCATAAGG + Intergenic
1164465612 19:28485107-28485129 GAATTTGACTAAGGGGCATAAGG + Intergenic
1164993191 19:32699280-32699302 AAGTTTGTCTGACAGGCATTAGG + Intronic
1165692359 19:37873531-37873553 GAATTCGACCGAGGGGCATAAGG + Intergenic
1165773585 19:38391931-38391953 AAGGTTGTCTGAGGGGCAGAAGG - Exonic
1166418503 19:42614173-42614195 GAATTTGACTAAGGGGCATAAGG - Intronic
1166498203 19:43320717-43320739 TAATTTGACTAAGAGGCATAAGG - Intergenic
1167222974 19:48215157-48215179 GAATTTGACTGAGGGGCATAAGG - Intronic
1167954831 19:53056427-53056449 AAATTCAACTGAGGGGCATAGGG - Intergenic
1168517890 19:57023662-57023684 GAATTTGACTGTGGGGCATAAGG - Intergenic
925552794 2:5094230-5094252 AAATTTGACTGAGGGGCATAAGG - Intergenic
925587459 2:5477357-5477379 GAATTTGACTAAGCGGCATAAGG - Intergenic
925751620 2:7094865-7094887 GAATTCAACTGAGGGGCATAAGG - Intergenic
925950134 2:8901898-8901920 AAGTTTGTCTGACAGGCATTAGG + Intronic
926439570 2:12874111-12874133 GTATTTGACTGAGGGGCATAAGG + Intergenic
926502711 2:13675580-13675602 GAATTTGAGTGAGGGGCATGAGG + Intergenic
926556495 2:14364028-14364050 GAATTCATCTGAGGGGCATAAGG + Intergenic
927351530 2:22123007-22123029 GAATTTGACTGAGGGGCATAAGG - Intergenic
927551922 2:24008965-24008987 GAATTCCACTGAGGGGCATAAGG + Intergenic
928183863 2:29091668-29091690 GAACTCGACTGAGGGGCATAAGG + Intergenic
928401026 2:30978916-30978938 CAAATTGTCTGAGGGGCAAGCGG + Intronic
928553310 2:32396321-32396343 AAAATTTGCTGAAGGGCATATGG + Intronic
928650552 2:33399736-33399758 GAATTTGACTGAGGGGTATAAGG + Intergenic
928854941 2:35791683-35791705 GAATTTGACTGAGGGGCATAAGG - Intergenic
929763612 2:44826212-44826234 AGATTTGTCTGGAGGGCAGAAGG - Intergenic
930119877 2:47751788-47751810 GAATTTGAGTGAGGGGCGTAAGG + Intronic
930591050 2:53326757-53326779 GAATTTGACTGAGGGGCACAAGG - Intergenic
930755853 2:54971298-54971320 AAGTGTGACTGAGGGGCTTACGG - Exonic
930771717 2:55136553-55136575 GAATTCATCTGAGGGACATAAGG - Intergenic
930898704 2:56477122-56477144 GAATTATGCTGAGGGGCATAAGG - Intergenic
930946938 2:57085759-57085781 GAATTCGACTGATGGGCATAAGG + Intergenic
931114433 2:59149054-59149076 GAATTCAGCTGAGGGGCATAAGG - Intergenic
932005588 2:67924003-67924025 CAATTCGAGTGAGGGGCATAAGG - Intergenic
932870223 2:75390943-75390965 CAATTTGACTGAGGGGCATAAGG + Intergenic
932961339 2:76415680-76415702 GAATTCAACTGAGGGGCATATGG - Intergenic
933069189 2:77836339-77836361 GAATTTGGCTGAGGGGCATAGGG - Intergenic
933563123 2:83913844-83913866 GAATTTGACCTAGGGGCATAAGG - Intergenic
934165686 2:89292141-89292163 GAATGCGACTGAGGGGCATAAGG - Intergenic
934201591 2:89890315-89890337 GAATGCGACTGAGGGGCATAAGG + Intergenic
934612296 2:95749962-95749984 AAATTTCTATGAGGGGTATATGG - Intergenic
934841856 2:97629486-97629508 AAATTTCTATGAGGGGTATATGG + Intergenic
934866891 2:97822061-97822083 AAGTTTGTCTGACAGGCATTAGG - Intronic
935299965 2:101685612-101685634 GAATTTGACTGAGCGGCATAAGG + Intergenic
935957440 2:108391442-108391464 CAACTTGACTGAGGAGCATAAGG - Intergenic
936035283 2:109106228-109106250 GAATTTCTCTAAGGGGCATAAGG - Intergenic
936746420 2:115581956-115581978 GAATTTGGCTGAGGGACAGAAGG + Intronic
936837798 2:116728561-116728583 GCATTTGACTGAGGGGCATTAGG - Intergenic
936840614 2:116764081-116764103 GAATTCGACTGAGGGGCATAAGG + Intergenic
936877864 2:117213999-117214021 GAATTCGTCTGAGAAGCATAAGG - Intergenic
938290757 2:130148858-130148880 GAATTCGACTGAGGGGCATAAGG + Intergenic
938465791 2:131524095-131524117 GAATTCGACTGAGGAGCATAAGG - Intergenic
938745138 2:134270890-134270912 AAAATTGTCTGATGGGAGTACGG - Intronic
939080943 2:137661572-137661594 TAATTCATCTGAGGGGCATAAGG + Intronic
939195015 2:138961146-138961168 GAATTCGACTGAGGGGCATCAGG + Intergenic
939207673 2:139128522-139128544 GAATTTAACTGAAGGGCATAAGG + Intergenic
939454149 2:142411089-142411111 AAAATTGACTGAGGAGCATAAGG - Intergenic
939577172 2:143909575-143909597 AAGTTTGACCGAGGGGCATAAGG - Intergenic
939854149 2:147336985-147337007 AAATTTGAATGAAGAGCATATGG + Intergenic
939858475 2:147389565-147389587 GAATTTGACTGAGGGGCATAAGG - Intergenic
940117531 2:150225476-150225498 GAATTTGACTGAGAGGCGTAAGG + Intergenic
940566197 2:155363940-155363962 CAATTCGGCTGAGGGACATAAGG - Intergenic
940782984 2:157952924-157952946 AAATTTGGCTAAGGGGCATAAGG - Intronic
940868440 2:158839475-158839497 GAATGGGACTGAGGGGCATAAGG - Intronic
940919998 2:159295668-159295690 GAATTCATCTGAGGGACATAAGG - Intergenic
942068963 2:172298087-172298109 AATTTTGTCTCTGGGGTATATGG - Intergenic
942619564 2:177833069-177833091 GAATTTGACTGAGGGGCGTTAGG - Intronic
942643862 2:178090076-178090098 AAATTTGTCTGAGATTCAAAAGG - Intronic
942782823 2:179666305-179666327 AATATCGTCTGAGAGGCATATGG + Intronic
943068914 2:183118682-183118704 GAATCTGACTAAGGGGCATAAGG + Intronic
943103299 2:183512045-183512067 AAGTTTGTCTGACAGGCATTAGG + Intergenic
943499940 2:188675035-188675057 GAATTTGACTGAAGTGCATAAGG - Intergenic
943633580 2:190280948-190280970 GAATTTGTCTAAGGGGCATAAGG - Intronic
943750324 2:191503671-191503693 GAATTCAACTGAGGGGCATAAGG - Intergenic
943903018 2:193465442-193465464 GAATTCGACTGAGGGGCATAAGG + Intergenic
943905160 2:193490067-193490089 GAATTTGACTGAGGGGTATAAGG - Intergenic
944050851 2:195467764-195467786 AAACTTTTGTTAGGGGCATAGGG + Intergenic
944553655 2:200867399-200867421 GAATTCGACTGAGGGGCAGAAGG - Intergenic
944586167 2:201175743-201175765 GAATTTGACTGAGGGGCATAAGG + Exonic
944872994 2:203933081-203933103 GAATTTGACTGAGAAGCATAAGG - Intergenic
945021457 2:205576462-205576484 TAATTTTTGTGAAGGGCATAAGG + Intronic
945568070 2:211429230-211429252 AAATGTGTCTGAGGGTGAAAAGG - Intronic
945608830 2:211972729-211972751 AAATTTGTGTATGTGGCATAAGG - Intronic
946053882 2:216884832-216884854 TAACTCGACTGAGGGGCATAAGG + Intergenic
946207587 2:218121048-218121070 AAGTTTGTCTGACAGGCATTAGG + Intergenic
946710682 2:222502032-222502054 AAATTTGTGAGGGTGGCATAAGG - Intronic
947237929 2:227963135-227963157 GAATTTGACCAAGGGGCATAAGG - Intergenic
1169642942 20:7775929-7775951 AAATTTGACTAATGGGCAAATGG - Intergenic
1169708717 20:8537103-8537125 GAATTTGACTGAGGGGCATAAGG + Intronic
1169874344 20:10280523-10280545 ATATTTGCCTTAGGTGCATAGGG + Intronic
1170235880 20:14104831-14104853 ATATTAGTATGAGGGTCATAGGG + Intronic
1170791617 20:19513481-19513503 AAATTAATGTGAGGGGCAGAGGG - Intronic
1171080562 20:22178583-22178605 ATATTTTTCTGAAGTGCATATGG + Intergenic
1171375764 20:24693299-24693321 CAAATTGGGTGAGGGGCATATGG + Intergenic
1175222352 20:57424667-57424689 AAATTTGTTTTAGGGGCCAATGG - Intergenic
1175294894 20:57901629-57901651 AGCCTTGTGTGAGGGGCATAAGG + Intergenic
1175631004 20:60536378-60536400 GAATTTGACTGAGGGGCAGAAGG + Intergenic
1175682786 20:61003135-61003157 TAATTCAACTGAGGGGCATAAGG - Intergenic
1177024436 21:15904832-15904854 AGATTTGACTGAGGGGCATAAGG - Intergenic
1177134850 21:17297777-17297799 AAGTTTGTCTGACAGGCATTAGG - Intergenic
1177530844 21:22355867-22355889 AAAATAGACTGAGGGGCATAAGG - Intergenic
1177547663 21:22579472-22579494 GAATTAGACTGAGGGGCATAAGG - Intergenic
1177559300 21:22729745-22729767 GAATTTGACTGAGGGGCATAAGG + Intergenic
1177702977 21:24662775-24662797 TAATTCGTCCAAGGGGCATAAGG + Intergenic
1177938995 21:27385721-27385743 GAATTTGACTGAGGGACGTAAGG + Intergenic
1178123087 21:29489256-29489278 GAATTTGAATGAGGGGCAGAAGG - Intronic
1178524805 21:33318553-33318575 AAATTCGACTGAGGGGCATAAGG - Intergenic
1178837558 21:36111681-36111703 GAATTTGACTGAGGGGCATAAGG - Intergenic
1179054735 21:37920636-37920658 GAATTCGACTGAGGGGCATAAGG - Intergenic
1179254819 21:39706497-39706519 GAATTTGACTGAGGGGCATAAGG + Intergenic
1179619136 21:42601125-42601147 GAATTAGACTGAGGGGCATAAGG + Intergenic
1179915540 21:44475713-44475735 TAACTCGTCTGAGGGGCATAAGG - Intergenic
1181110028 22:20596879-20596901 GAATTCAACTGAGGGGCATAAGG + Intergenic
1181563376 22:23718464-23718486 GAATTTGACCGAGGGTCATAAGG + Intergenic
1183445745 22:37853264-37853286 GAATTCGACTGAGGGGCACAAGG + Intronic
1183606380 22:38868825-38868847 AGTCTTGTCTGAGAGGCATATGG - Intronic
1184933414 22:47698809-47698831 AAATTCAACTGAGGGGCATAAGG + Intergenic
949449205 3:4166637-4166659 AAGTTTGTCTGACAGGCATTAGG + Intronic
949676453 3:6459837-6459859 GAACTTGACTGAGGGGCATAAGG + Intergenic
949786099 3:7743691-7743713 GAATTCGACTAAGGGGCATAAGG + Intergenic
950373443 3:12550703-12550725 GAATTCGACTGAGGGGCATAAGG - Intronic
950417692 3:12877604-12877626 AAATCTGCCTGAGAGGCATGAGG + Intergenic
950869457 3:16216205-16216227 GAATTCAACTGAGGGGCATAAGG + Intronic
951450787 3:22836125-22836147 AAATTCATCTGAGGGGCATAAGG + Intergenic
952337330 3:32415218-32415240 AACTTTGGCTGAGGGGCCCAGGG + Intronic
952454132 3:33457107-33457129 AAATTCGACTGAGGGGCATAAGG + Intergenic
952555282 3:34523421-34523443 AAATTTGTCTGACAGGCATTAGG + Intergenic
952675818 3:36029194-36029216 GAATTTGACTGAAGGGCATAAGG + Intergenic
952687322 3:36164564-36164586 GATTTTGTCTGTGGGGCATACGG - Intergenic
952941188 3:38445489-38445511 AAGTTTGTCTGACAGGCATTAGG + Intergenic
953194546 3:40720232-40720254 GAATTTGTCTGAGGGGCATAAGG - Intergenic
953259335 3:41322394-41322416 AAATTTGTCTGAGGGGCATAAGG - Intronic
953798940 3:46006634-46006656 GAATTCAACTGAGGGGCATAAGG - Intergenic
953812363 3:46124215-46124237 GAATTTGACTAAGGGGCATAAGG - Intergenic
954349979 3:50035160-50035182 CAATTTGACTGAGGGTCATAAGG + Intronic
954588211 3:51755663-51755685 GAATTTGTTTGATGGGCTTATGG - Intergenic
954889574 3:53912932-53912954 GAATTTGACTGAGGGGCATAAGG + Intergenic
955266822 3:57452085-57452107 GAATTCAACTGAGGGGCATAAGG - Intronic
955319999 3:57967631-57967653 GAATTTGACTGAGGGGCAAAAGG + Intergenic
955548723 3:60059614-60059636 GAATTCAGCTGAGGGGCATAAGG - Intronic
955824989 3:62936639-62936661 GAATTCGACTGAGGGGTATAAGG + Intergenic
956297389 3:67729152-67729174 AAATCTGCCTGAGGGGTCTAAGG + Intergenic
956577694 3:70772212-70772234 CAATTTGTCTTATGGGCAAAAGG - Intergenic
956882357 3:73523575-73523597 AAGTTTTACTGAGGGTCATAAGG + Intronic
957130971 3:76222253-76222275 GAATCTGACTGAGAGGCATAAGG + Intronic
957222599 3:77402958-77402980 GAATTCAACTGAGGGGCATAAGG - Intronic
957275083 3:78080747-78080769 GAATTTGATTGAGGGACATAAGG - Intergenic
957287406 3:78234557-78234579 AAATTCAGCTGAGGGGCATAAGG + Intergenic
957556992 3:81774759-81774781 AAAGTTGTGTGAAGGGCATATGG + Intergenic
957610806 3:82462946-82462968 GAATTTGACTAAGGAGCATAAGG + Intergenic
957684058 3:83476980-83477002 AATTTTGTTTGAGGAGTATAAGG + Intergenic
958435422 3:94089852-94089874 GAATTAGACTGAGGGGCATAAGG - Intronic
958603765 3:96332058-96332080 GAATTCGACTGAGAGGCATAAGG - Intergenic
959646457 3:108708617-108708639 TAATTTTTATGAAGGGCATAAGG + Intergenic
959649532 3:108738129-108738151 GAATTTGACGGAGGGGCATAAGG - Intergenic
960709412 3:120512277-120512299 GAATTCAACTGAGGGGCATAAGG - Intergenic
961481007 3:127180791-127180813 GAATTCGTCAGAGGGGCATAAGG - Intergenic
962879401 3:139562108-139562130 AAATTGTTCTGGGGTGCATATGG - Intronic
963021037 3:140873310-140873332 AAGTTTGTCTGATGGGCATTAGG - Intergenic
963230745 3:142906661-142906683 GAATTCGACTGAGGGGCATATGG - Intergenic
963458058 3:145572678-145572700 GAATTTGACTGAGTGGCATAAGG + Intergenic
964249793 3:154699742-154699764 GAATTCAACTGAGGGGCATAAGG - Intergenic
964409786 3:156386083-156386105 TAATTTGACAAAGGGGCATAAGG + Intronic
964862366 3:161216975-161216997 GAATTTGACTGAGGGGCATAAGG - Intronic
964973241 3:162586971-162586993 GAATTCGACTAAGGGGCATAAGG - Intergenic
965071536 3:163922050-163922072 TAATTCCTCTGAGGGACATAAGG + Intergenic
966162620 3:176984154-176984176 GAACTCGACTGAGGGGCATAAGG - Intergenic
966498148 3:180603923-180603945 AAATTTGTCTAAAAGGTATAAGG - Intronic
967430758 3:189382738-189382760 GAATTCGGCTGAGGGGCACAAGG + Intergenic
967974869 3:195028176-195028198 GAATTTGACTGACGGGCCTAAGG - Intergenic
969335754 4:6509017-6509039 GGATTCGTCTGAGGGGCAAAAGG - Intronic
969348435 4:6583630-6583652 GAATTCGACTGAGGGGCATAAGG + Intronic
970269350 4:14327238-14327260 AAATTAGTCTGCCGGGCACAGGG + Intergenic
970297875 4:14650570-14650592 AGATGTGTCGGAGGGGGATAAGG + Intergenic
970422757 4:15920493-15920515 GAATTTGACAGAGGGGCATAAGG - Intergenic
970471103 4:16380048-16380070 GAATTAGACTGAGGGGCATAAGG + Intergenic
971279363 4:25229835-25229857 CAATTCCACTGAGGGGCATAAGG + Intronic
971477875 4:27089407-27089429 GAATTTGGCCAAGGGGCATAAGG + Intergenic
971578251 4:28303978-28304000 AAGTTTGTCTGACAGGCATTAGG - Intergenic
971787157 4:31119475-31119497 GAATTTGACTCAGGGGCATAAGG + Intronic
971860354 4:32094092-32094114 GAATTTGACTGAGGGGCATAAGG + Intergenic
971955823 4:33416949-33416971 GAATTTGACTGAGGGGCATAAGG - Intergenic
971967374 4:33577808-33577830 GAATTTGACCGAGGGGCATGAGG + Intergenic
972241875 4:37202236-37202258 GAATTTGACTGAGGGGCATAAGG - Intergenic
972411911 4:38803340-38803362 GAATTTGTGTGAGGGGCATAAGG - Intronic
972865031 4:43221544-43221566 GAATACGACTGAGGGGCATAAGG + Intergenic
973014210 4:45116817-45116839 AATTACCTCTGAGGGGCATAAGG - Intergenic
973838484 4:54836021-54836043 AAATTTGTCACAGGGTGATATGG - Intergenic
973930490 4:55789032-55789054 GTATTCGACTGAGGGGCATAAGG + Intergenic
974250994 4:59382479-59382501 GAATTCGACTGAGGTGCATAAGG - Intergenic
974462350 4:62204572-62204594 GAATTTGACTGAGGGGCATAAGG - Intergenic
974612441 4:64233222-64233244 AAAATGGACTGAGAGGCATATGG + Intergenic
974664231 4:64937256-64937278 TAATTTGACTGAGTTGCATATGG + Intergenic
974691234 4:65300079-65300101 GAATTTGACTGAGGGGCATAAGG + Intergenic
974840090 4:67289371-67289393 GAATTTGACTGAGGGGAATAAGG - Intergenic
974876570 4:67710154-67710176 GAATTTGACTGAGGGGCATAAGG + Intergenic
974945297 4:68519624-68519646 GAATTTGACTGAGCGGCATAAGG - Intergenic
974955209 4:68630893-68630915 GAATTTGATTGAGGGGCACAAGG - Intronic
975033370 4:69652082-69652104 GAATTTGACTGGGGGGCATCAGG - Intronic
975047763 4:69825819-69825841 AAGTTTGTCTGACAGGCATTAGG - Intronic
975397636 4:73895533-73895555 TAATTTGACGGAGGGGCATAAGG - Intergenic
975703463 4:77089000-77089022 GAATTTGACTGAGGGGCATAAGG + Intergenic
976004964 4:80419079-80419101 GAATTTGACTGAGGACCATAAGG + Intronic
976008548 4:80459565-80459587 GAATTTGACTGAGGGGCATAAGG - Intronic
976174570 4:82338135-82338157 AAGTTTGTCTGACAGGCATTAGG + Intergenic
976184025 4:82428211-82428233 AAATTTTTCTGGGGGTTATATGG - Intronic
976818270 4:89175219-89175241 GAATTTGACTGAGGGGCATAAGG - Intergenic
977261784 4:94805664-94805686 ATATTTTTCTGATGGGGATAGGG + Intronic
977835145 4:101637285-101637307 AAGTTTGTCTGACAGGCATTAGG + Intronic
977867769 4:102050206-102050228 GAATTCAGCTGAGGGGCATAAGG - Intronic
977869204 4:102070066-102070088 GAATTTGACAGAGGGGCATAAGG + Intronic
978938577 4:114410217-114410239 GAATTTGACTGAAGGGCATAAGG + Intergenic
978979337 4:114922624-114922646 GAATTTGACCAAGGGGCATAAGG - Intronic
979056126 4:115997421-115997443 GAATTTGACTGACGGGCATAAGG + Intergenic
979065205 4:116122871-116122893 GAATGCGACTGAGGGGCATAAGG + Intergenic
979803292 4:124938430-124938452 GAATTCGACTGAGGGCCATAAGG - Intergenic
979940150 4:126752205-126752227 GAATTCGACTGAGGAGCATAAGG + Intergenic
980160116 4:129150680-129150702 GCATTTGACTGAGGGGCGTAAGG - Intergenic
980798418 4:137715100-137715122 GATTTTGACTGAGGGGCATAAGG - Intergenic
981447921 4:144861851-144861873 GAATTCGACTGAGTGGCATAAGG + Intergenic
982103746 4:151993591-151993613 GCATTTGACTGAGGGGCATAAGG + Intergenic
982877054 4:160663249-160663271 AAGTTTGTCTGACAGGCATTAGG - Intergenic
983038687 4:162898615-162898637 GAATTTGACTGAGGGGCATAAGG + Intergenic
983365070 4:166776078-166776100 AAATTTGACAGAGGGACAGAAGG + Intronic
983406309 4:167335468-167335490 GAATTTGACTGAGGGGCATAAGG + Intergenic
983713031 4:170743491-170743513 GAATTTGAATGAGGGACATAAGG + Intergenic
983904909 4:173172017-173172039 GAATTTATTGGAGGGGCATAAGG + Intronic
984084479 4:175291986-175292008 GAAATTGACTGAGGGGCATAAGG + Intergenic
984113092 4:175644309-175644331 GAATTCAACTGAGGGGCATAAGG - Intronic
984351409 4:178599802-178599824 TAATTCAACTGAGGGGCATAAGG + Intergenic
984918659 4:184744995-184745017 GAATTTGACCAAGGGGCATAAGG - Intergenic
986066615 5:4240618-4240640 TAATTTGACGGAGGGGCAGAAGG - Intergenic
986219237 5:5752488-5752510 GAATTCAACTGAGGGGCATAAGG - Intergenic
986411500 5:7485286-7485308 AAAGTTATCTGAGAGGCAAAAGG + Intronic
986454596 5:7903688-7903710 GAATTCAACTGAGGGGCATAAGG + Intronic
986476784 5:8142652-8142674 GAATTCGACTGAGAGGCATAAGG + Intergenic
986538073 5:8813512-8813534 GAATTTGACTGCAGGGCATATGG - Intergenic
986751640 5:10792985-10793007 GAATTTGACTGAGAGGCATAAGG - Intergenic
986977135 5:13408071-13408093 GGATTTGACTGAGGGGCAGAAGG + Intergenic
986977805 5:13412580-13412602 GAATTTGACTGAGGGGCATAAGG - Intergenic
987572094 5:19676978-19677000 TATTTTGACTGAAGGGCATAAGG - Intronic
987620248 5:20330919-20330941 GAATTTGTTTGGGGGACATAAGG - Intronic
987655012 5:20796203-20796225 GAATTTGACTGAGGAGCATAAGG - Intergenic
988131169 5:27108226-27108248 GAATTTGACTGAGGGGCATAAGG + Intronic
988225407 5:28405885-28405907 AAATTTATCTAAGGGTCACAGGG - Intergenic
988242616 5:28633173-28633195 GAAATTGACTGAGAGGCATAAGG - Intergenic
988357583 5:30198602-30198624 AAGTTTGTCTGACAGGCATTAGG - Intergenic
988583859 5:32491900-32491922 AAATTTGACCAAGGGGCATAAGG + Intergenic
988768551 5:34407699-34407721 GAATTTGACTGAGGAGCATAAGG + Intergenic
989183753 5:38603264-38603286 GAATTCAACTGAGGGGCATAAGG - Intronic
989785971 5:45330061-45330083 AAAATTGTGTAAGGGGCACATGG - Intronic
989820821 5:45794242-45794264 AAATTCAACTGAAGGGCATAAGG + Intergenic
989999828 5:50879903-50879925 GAATTTGACTGAAAGGCATAAGG - Intergenic
990018581 5:51097963-51097985 GAATTCCACTGAGGGGCATAAGG + Intergenic
990114280 5:52369284-52369306 GAATTTGACTGAGGGGCATAAGG + Intergenic
990116488 5:52398200-52398222 AAGTTTGTCTGACAGGCATTAGG - Intergenic
990213126 5:53502063-53502085 GAATTTGACTGAGGGGCATAAGG + Intergenic
990318054 5:54602564-54602586 GAATTAGACTGAGGGGCATAAGG + Intergenic
990896109 5:60701418-60701440 GAGTTCGACTGAGGGGCATAAGG + Intergenic
991657620 5:68919900-68919922 GAATTTGACTGAGAGGCATAAGG + Intergenic
991686351 5:69185747-69185769 GGATTTGACTGAGGGGCATAAGG + Intergenic
992399123 5:76395545-76395567 GAATTCGACTGAGGGGCATAAGG - Intergenic
992540318 5:77757972-77757994 GAATTCGACTGAGGGGTATAAGG + Intronic
993021184 5:82593320-82593342 AAATATGTCTGTGGTGAATATGG - Intergenic
993177255 5:84502726-84502748 CAATTTGACTGAGGGGCAGAAGG + Intergenic
993364865 5:87022829-87022851 GAATTTGACTGAGCAGCATAAGG - Intergenic
993406992 5:87524304-87524326 GAATTTGACTGAGGCGCATAGGG + Intergenic
993724411 5:91351853-91351875 GAATTTGACTAAGGAGCATAAGG - Intergenic
993811719 5:92487437-92487459 AAATCTGTCTGTGTGGCACAAGG - Intergenic
994196575 5:96929274-96929296 GAATTCTGCTGAGGGGCATAAGG - Intronic
994281437 5:97908179-97908201 GAATTTGGCTGAGGGGCATAAGG - Intergenic
994754017 5:103772832-103772854 AAATTCGACTGAGGGGCATAAGG - Intergenic
995105969 5:108379034-108379056 AACTTTGTCTAAAGGACATATGG - Intronic
995130053 5:108620568-108620590 GAATTTGACGGAGGGGCATAAGG + Intergenic
995191400 5:109322450-109322472 GAATTTGACTGAGGGGCATAAGG - Intergenic
995482898 5:112610405-112610427 GAATTCAACTGAGGGGCATAAGG - Intergenic
996151132 5:120036213-120036235 GAATTCAACTGAGGGGCATAAGG - Intergenic
996281788 5:121739062-121739084 GAATTCAACTGAGGGGCATAAGG + Intergenic
996567690 5:124897418-124897440 GAATTTCACAGAGGGGCATATGG - Intergenic
996567774 5:124898140-124898162 ATATTTCTCTGATGGGAATAAGG - Intergenic
996953383 5:129155018-129155040 GAATTTGACTGAGGGGCATAAGG + Intergenic
996998130 5:129724474-129724496 GAATTTGACTGAGAAGCATAAGG + Intronic
998111214 5:139504198-139504220 AAGTTTGTCTGACAGGCATTAGG - Intergenic
998172318 5:139879914-139879936 GTTTTTGTCTGAGGGTCATAGGG + Intronic
998571924 5:143268126-143268148 TAATTTTTGTGAAGGGCATAGGG + Intergenic
998796094 5:145820703-145820725 GAATTCGACTGAGGGGCATAAGG + Intronic
998942142 5:147296190-147296212 AAATTCAACTGAGGGGCATAAGG + Intronic
1000089575 5:157918645-157918667 AAATTTGACCGAAGGGCACAAGG + Intergenic
1000766576 5:165299132-165299154 GAATTTGACCGAGGGGCATAGGG + Intergenic
1000929050 5:167229970-167229992 AAATTTGTCCTCAGGGCATATGG + Intergenic
1003201897 6:3969140-3969162 GAATTTGGCTGAGGGGCATAAGG + Intergenic
1003805539 6:9723115-9723137 AAGTTTGTCTGATAGGCATTAGG - Intronic
1004811993 6:19272206-19272228 AAGTTTGTCTGACAGGCATTAGG - Intergenic
1005621345 6:27623450-27623472 TAATTTGTCCGAGGGGCATAAGG + Intergenic
1005812157 6:29525904-29525926 GAATTCGACTGAGGGGCATACGG + Intergenic
1006017994 6:31097745-31097767 GAATTTGACTGAGGGGCATAAGG - Intergenic
1006221535 6:32495930-32495952 AAGTTTGTCTGACAGGCATTAGG - Intergenic
1007163571 6:39812023-39812045 GAATTTGTATCTGGGGCATAGGG + Intronic
1007196440 6:40065486-40065508 AAATTTGACTGTGAGACATAGGG - Intergenic
1007847178 6:44768980-44769002 GAATTCAACTGAGGGGCATATGG + Intergenic
1008570985 6:52816392-52816414 AAATTTGTCTGATTGGCAGTTGG + Intergenic
1009386192 6:63085856-63085878 AAATTTGTCTGAAAAGCATTAGG + Intergenic
1009401551 6:63262295-63262317 GAATTTGACTGAGGAGCATAAGG + Intergenic
1009649345 6:66453107-66453129 AAATATGTCTAAGGGGCATGAGG - Intergenic
1009684007 6:66932984-66933006 GAATATGACTGCGGGGCATAAGG - Intergenic
1010105951 6:72168248-72168270 GAATTTGACTGAGGGGTTTAAGG + Intronic
1010977294 6:82330047-82330069 GAATTCGACTGAGGGGCATAAGG - Intergenic
1011290460 6:85771772-85771794 TAATTCGACTGAGGAGCATAAGG + Intergenic
1011314046 6:86011545-86011567 GAATTCGACTGAGGGCCATAAGG - Intergenic
1012000230 6:93645186-93645208 GAATCTGACTGAGGAGCATAAGG - Intergenic
1012441789 6:99267733-99267755 AAGTTTGTCTGACAGGCATTAGG + Intergenic
1012707454 6:102550077-102550099 AAATTAGTCTGAGGTACACAAGG + Intergenic
1014738357 6:125121178-125121200 GAATTCGACTGAGGGACATAAGG + Intronic
1014768383 6:125433724-125433746 GAATTTGACCAAGGGGCATAAGG + Intergenic
1015282519 6:131448955-131448977 AAAATTGTCTGTGGGGAGTATGG - Intergenic
1015580067 6:134714651-134714673 GAATTCGACTAAGGGGCATAAGG + Intergenic
1015645357 6:135381269-135381291 AAATTTGTCTGAGAAATATAGGG - Intronic
1015824856 6:137300793-137300815 GAATTTGACTGAGGGGCATAAGG + Intergenic
1016126707 6:140412397-140412419 GACTTTGATTGAGGGGCATAAGG - Intergenic
1016183770 6:141177063-141177085 AAGTTTGTCTGACAGGCATTAGG - Intergenic
1016363218 6:143290160-143290182 TAATTTGACCAAGGGGCATAAGG + Intronic
1017106222 6:150890659-150890681 GAATTGGACTGAGGGCCATAAGG + Intronic
1017426974 6:154332049-154332071 GAATTTGGCTGAGGGGCATAAGG - Intronic
1017779832 6:157707279-157707301 AAATTGGACTTAGGGGCACAAGG + Intronic
1018134901 6:160769616-160769638 GAATTTGACTGAGGGGCATGAGG - Intergenic
1018664769 6:166125572-166125594 GAATTTGACCGAGGGGCACAGGG + Intergenic
1019041640 6:169110755-169110777 GAATTCAACTGAGGGGCATAAGG + Intergenic
1019817733 7:3213429-3213451 GAATTCGACTGAGGGGCATAAGG - Intergenic
1020587292 7:10085092-10085114 GAATTTGACTGAGGAGCATGGGG + Intergenic
1020788459 7:12595953-12595975 GAATTCGACTGACGGGCATAAGG + Intronic
1020978948 7:15043985-15044007 TAAGTTGTCTGAGGGGCATAAGG + Intergenic
1021506381 7:21390034-21390056 GAATTTGACTGAGGAGCATAAGG - Intergenic
1021756981 7:23861176-23861198 AAGTTTGTCTGAGAGGCATTAGG + Intergenic
1023078198 7:36503770-36503792 AAGTTTGTCTGACAGGCATTAGG + Intergenic
1023189973 7:37570014-37570036 GAATTCCACTGAGGGGCATAAGG + Intergenic
1023684308 7:42719049-42719071 GAATTTGTCTGAGGAGCATAAGG + Intergenic
1024239168 7:47420789-47420811 GAATTTGACTGAGGGATATAAGG - Intronic
1024406395 7:48986554-48986576 AAATTTCTCTAAAGTGCATATGG - Intergenic
1025929640 7:65983322-65983344 GAATTGCACTGAGGGGCATAAGG + Intergenic
1026221721 7:68404328-68404350 GAATTTGACTGAGGGACGTAAGG + Intergenic
1026352194 7:69527104-69527126 GAATTTGACTGAGGGGCATAAGG - Intergenic
1027596783 7:80184169-80184191 GAATTCGGCCGAGGGGCATAAGG + Intronic
1027616558 7:80431309-80431331 GAATTTGACTGAGGGGCATAAGG - Intronic
1027627363 7:80563191-80563213 AAATTTGGCTGAGGCTCAGATGG - Intronic
1028495479 7:91455510-91455532 AAGTTTGTCTGACAGGCATTAGG + Intergenic
1028581186 7:92411167-92411189 AACTTTGACTGAGGAGCATAAGG + Intergenic
1029499424 7:100918947-100918969 TAATTCCTCTGAGGGGCATAAGG - Intergenic
1030225087 7:107141733-107141755 AAATATTTCACAGGGGCATAAGG + Intronic
1030257744 7:107529803-107529825 GAATTCGACTGAGGGGCATAAGG - Intronic
1030414795 7:109229678-109229700 GAATTTATCTGAGGGGCATAAGG + Intergenic
1030420260 7:109300104-109300126 AAGTTTGTCTGACAGGCATTAGG - Intergenic
1030484232 7:110146334-110146356 AAATTTATCTGAGGGGCATATGG - Intergenic
1030515554 7:110533799-110533821 GAATTTGACTGAGAGGCATAAGG - Intergenic
1030816843 7:114049328-114049350 GAATTTGGCTGAATGGCATAAGG - Intronic
1030825751 7:114155712-114155734 GAATTTGATTGAGGGGCATAAGG + Intronic
1030856927 7:114570050-114570072 GATTTTGTCTGAAGGGCAAAAGG - Intronic
1031469478 7:122151865-122151887 TAATTCAGCTGAGGGGCATAAGG + Intergenic
1031982700 7:128137983-128138005 AAATGTGTTTGAGGAGCTTAAGG + Intergenic
1032371419 7:131356864-131356886 GAATTCGAATGAGGGGCATAAGG + Intronic
1032713835 7:134487216-134487238 AAGTTTGTCTGACAGGCATTAGG + Intergenic
1033447962 7:141438499-141438521 ACCTTTGTCTGAGGGGTAGATGG - Intronic
1034222014 7:149454162-149454184 AAACCTGTCTGAGTGGCAGAAGG - Exonic
1034685621 7:152968364-152968386 GAATTTGACTGAGGGCCATAAGG - Intergenic
1035173688 7:157035318-157035340 TCATTTGTCTCAGGGTCATATGG + Intergenic
1035862845 8:3048558-3048580 TAATTTTTCTGAAGGGCAAAAGG - Intronic
1036625967 8:10471782-10471804 GAGTTTGACTGAGGGGCATAAGG + Intergenic
1037020157 8:13960139-13960161 GAATTCAACTGAGGGGCATAAGG + Intergenic
1037132874 8:15427673-15427695 GAATTTGACTGAGGGGCATAAGG - Intronic
1037135437 8:15454331-15454353 GAATTCAACTGAGGGGCATAAGG - Intronic
1037714934 8:21389436-21389458 AAACCTGTATGAAGGGCATAAGG + Intergenic
1037958561 8:23078151-23078173 GAATTCGACTGAGGGTCATAAGG + Intergenic
1037962460 8:23108072-23108094 GAACTGGTTTGAGGGGCATAAGG + Intronic
1037968976 8:23158222-23158244 GAATTGGACTGAGGGGCATAAGG - Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038464262 8:27745787-27745809 AAAGTTGTCTGTGTGGCACACGG + Intronic
1039095965 8:33885669-33885691 GAATTTGACTGAGGGGCATAAGG + Intergenic
1039275742 8:35932943-35932965 AAGTTTGTCTGACAGGCATTAGG - Intergenic
1039500061 8:38009581-38009603 GAATTCGACTGAGGGGCATAAGG - Intergenic
1039693425 8:39884510-39884532 AAGTTTGTCTGACAGGCATTAGG + Intergenic
1039959213 8:42232824-42232846 GAATTTGACTGAGGGGCATAAGG + Intergenic
1039999957 8:42567339-42567361 AAGTTTGTCTGACAGGCATTAGG + Intergenic
1040665103 8:49622049-49622071 ACATTTGACTAAGGGACATAAGG - Intergenic
1040753626 8:50742220-50742242 ACATTTTTCTGAAGGGCACATGG + Intronic
1041001647 8:53460484-53460506 AAGTTTGTCTGACAGGCATTAGG - Intergenic
1041351094 8:56948255-56948277 GAATTTGACCAAGGGGCATAAGG - Intergenic
1041377276 8:57217054-57217076 GAGTTTGACTGAGGGGCATGAGG + Intergenic
1041395654 8:57388309-57388331 AAATTTGACTGAGGGGCATAAGG - Intergenic
1041409734 8:57540430-57540452 GAATTTGTCCAAGGGACATAAGG + Intergenic
1041482814 8:58342440-58342462 GAATTTGACTGAGGGGCATAAGG + Intergenic
1041720782 8:60973495-60973517 GAATTCAACTGAGGGGCATAAGG + Intergenic
1041810453 8:61902754-61902776 GAATTTGACTGAGACGCATAAGG + Intergenic
1042311214 8:67380953-67380975 AAATTCCACTAAGGGGCATAAGG - Intergenic
1042761745 8:72278637-72278659 AAAATTGCCTGAGGGGCATGAGG - Intergenic
1043344566 8:79285152-79285174 AAATTCAGCTGAGGGGCATAAGG + Intergenic
1043401208 8:79886099-79886121 AAAATTGTCTGTTGGGCTTATGG + Intergenic
1043599582 8:81920673-81920695 GAATTCAACTGAGGGGCATAAGG - Intergenic
1043853456 8:85239912-85239934 GAATTTGACCAAGGGGCATAGGG - Intronic
1044003683 8:86916174-86916196 GAATTTGACTAAGGGGCATGAGG + Intronic
1044085512 8:87937772-87937794 GAATTCGACTGAGGGGCATAAGG - Intergenic
1044123357 8:88425607-88425629 GAATTTAACTGAGGGGCATAAGG - Intergenic
1045427762 8:102084328-102084350 TAATTTGACTGAGGGGCATAAGG + Intronic
1045646511 8:104304898-104304920 GAATTTGACCGAGAGGCATAAGG + Intergenic
1045919952 8:107518070-107518092 GAATTTGACCAAGGGGCATAAGG - Intergenic
1045977719 8:108148580-108148602 GAATTCGGCTGAGGGTCATAAGG + Intergenic
1045994540 8:108347451-108347473 AAAATTCTCTGTGGGGTATATGG - Intronic
1046028257 8:108750974-108750996 GAATTTGACTAAGGGTCATAGGG - Intronic
1046184301 8:110692978-110693000 GAATTTGACTAAGGGGCATAAGG + Intergenic
1046386977 8:113518537-113518559 TAATTTGACTGAGGGACATAAGG - Intergenic
1046387958 8:113527457-113527479 TAATTTTACTGAGTGGCATAAGG - Intergenic
1047152944 8:122285021-122285043 GAATTTGACGGAGGGGCATAAGG - Intergenic
1047871755 8:129090894-129090916 GAATTCAACTGAGGGGCATAAGG + Intergenic
1048117841 8:131545262-131545284 GAATTTGATTGAAGGGCATAAGG + Intergenic
1048128460 8:131663800-131663822 GAATTTGACTGAGGGGCATAAGG - Intergenic
1048522778 8:135172072-135172094 TAATTGGACTGAGAGGCATACGG - Intergenic
1050588623 9:7139850-7139872 TAATTTGACTCAGGGGCATAAGG + Intergenic
1051080548 9:13288772-13288794 GAATTAAACTGAGGGGCATACGG - Intergenic
1051972979 9:22913370-22913392 GAATGTGACTGCGGGGCATAAGG - Intergenic
1051991259 9:23154847-23154869 GAATTTGACTGAGGGCTATAAGG - Intergenic
1052160762 9:25255700-25255722 GAATTCGACCGAGGGGCATAAGG - Intergenic
1052424709 9:28289918-28289940 GAATTTGTATGAAGGGCATGGGG - Intronic
1052517593 9:29503264-29503286 GAATTCAACTGAGGGGCATAAGG + Intergenic
1052547606 9:29900382-29900404 TAATTAGACTGAGGGGTATAAGG + Intergenic
1053092658 9:35293602-35293624 AATTAAGTCTGAGTGGCATATGG + Intronic
1053451273 9:38196206-38196228 GAATTTGTCCAAGGGGCATAAGG - Intergenic
1055199694 9:73645659-73645681 GAATTTGATGGAGGGGCATAAGG + Intergenic
1055998768 9:82192273-82192295 GAATTCGACTGAGGGGCCTAAGG + Intergenic
1056393051 9:86156369-86156391 AAGTTTGTCTGACAGGCATTAGG + Intergenic
1056435180 9:86569035-86569057 GAATTTGACTGAGGGGCCTAAGG + Intergenic
1058143436 9:101382657-101382679 GAATTCAACTGAGGGGCATAAGG - Intronic
1058247855 9:102653189-102653211 GAATTTGACTGAGGGACATAAGG - Intergenic
1058278193 9:103074469-103074491 GAATTAGACTGAGAGGCATAAGG + Intergenic
1058300973 9:103372758-103372780 GAATTCGACCGAGGGGCATAAGG + Intergenic
1058888273 9:109339455-109339477 AATTTTATCTGAAGGGCCTAGGG - Intergenic
1059479866 9:114580857-114580879 GAATTTGACCCAGGGGCATAAGG - Intergenic
1059849406 9:118320595-118320617 GAATTGGACTGAGGGGCATGAGG + Intergenic
1185699546 X:2220104-2220126 AGATTGCTCTGAGGGGTATAAGG + Exonic
1185757508 X:2663414-2663436 GAATTTGACTGAGGGCCATAAGG - Intergenic
1185886738 X:3790006-3790028 GAATTTGACTGAAGGGCATAAGG - Intergenic
1186216214 X:7303879-7303901 AAATATGAGTGAAGGGCATATGG - Intronic
1186329549 X:8517750-8517772 AAATTCAACTGAGGGGCATAAGG + Intergenic
1187036428 X:15545190-15545212 GGATTCATCTGAGGGGCATAAGG + Intronic
1187509940 X:19908629-19908651 AAATTGGACTGAGAGGCATAAGG + Intergenic
1187750127 X:22453906-22453928 AAATTTATCTGATTGGGATATGG + Intergenic
1188136231 X:26498281-26498303 AAGTTTGTCTGATAGGCATTAGG - Intergenic
1188284489 X:28311491-28311513 GAATTTGACTGAGGGGCATAAGG + Intergenic
1188752179 X:33918610-33918632 GAATTTGACTGAGGAGCACAAGG + Intergenic
1188808430 X:34620854-34620876 CAATTTGTCTTAAGGGCCTAAGG + Intergenic
1188881165 X:35493508-35493530 GAATTTGACCGAGGGGCATAAGG - Intergenic
1188883344 X:35518054-35518076 GAATTAGACTGAGGGGCATAAGG + Intergenic
1188898619 X:35700179-35700201 GAATTTGACTGAGGGGCATAGGG + Intergenic
1188953687 X:36408200-36408222 GAATTCGACTGAGGGGCATAAGG - Intergenic
1188989797 X:36803580-36803602 GAATTCTGCTGAGGGGCATAAGG - Intergenic
1189161961 X:38818492-38818514 ATATTTGGGTGAGGGGTATATGG + Intergenic
1189492470 X:41480933-41480955 GAATTTGTCCAAGGGGCATAAGG - Intergenic
1190704250 X:53013284-53013306 GAATTTGACCAAGGGGCATAAGG + Intergenic
1190771862 X:53521463-53521485 GAATTTGACTGAGGGGTACAAGG + Intergenic
1192230889 X:69264245-69264267 AAATTTGTCCTGGGGGCAGACGG + Intergenic
1192811889 X:74554383-74554405 GAATTCAACTGAGGGGCATAAGG + Intergenic
1192859302 X:75048651-75048673 AAAATTGTCTTAAGGGCATATGG - Intergenic
1193330729 X:80232834-80232856 GCTTTTGACTGAGGGGCATAAGG + Intergenic
1193486146 X:82087208-82087230 GAATTTAACTGAGGGGAATATGG - Intergenic
1193518726 X:82503044-82503066 GAATTTGACTGAGGGGAATAAGG - Intergenic
1193583769 X:83295299-83295321 GAATTTGACTGAGGGGTATAAGG - Intergenic
1193731865 X:85111985-85112007 GAATTAGACTGAGGGGCATAAGG + Intergenic
1193732465 X:85117301-85117323 TAATTTGACTGAGGGAAATAAGG - Intergenic
1193919195 X:87405131-87405153 CAATTAGGCTGAGGGGTATAAGG - Intergenic
1193974660 X:88102491-88102513 GAATTTGACTAAGGGGTATAAGG + Intergenic
1193994137 X:88344288-88344310 GAATTCAACTGAGGGGCATAAGG + Intergenic
1194111518 X:89839805-89839827 TATTTCGACTGAGGGGCATAAGG - Intergenic
1194123224 X:89986040-89986062 TAATTTGACTAAGGAGCATAGGG + Intergenic
1194127855 X:90042020-90042042 AAATTTGACTGAGGGGTACAAGG + Intergenic
1194169701 X:90565979-90566001 AAATTCAAATGAGGGGCATAAGG + Intergenic
1194170619 X:90575925-90575947 GAATTCAACTGAGGGGCATAAGG + Intergenic
1194215238 X:91123343-91123365 AAATTCAACTGAGGGGCATAAGG - Intergenic
1194234175 X:91361663-91361685 GAATATGAATGAGGGGCATAAGG + Intergenic
1194627594 X:96243657-96243679 GAATTTGACTGAGGGGCATAAGG + Intergenic
1194810610 X:98382952-98382974 GAATTTGACTGAGGGGCATAAGG - Intergenic
1195220433 X:102741120-102741142 GAATTTGACTGAGGGGCATAAGG + Intronic
1195256795 X:103098830-103098852 GAATTTGACTGAGGGGCATAAGG + Intergenic
1195258521 X:103111262-103111284 GAATTCAACTGAGGGGCATAAGG - Intergenic
1195327322 X:103768438-103768460 AAATGTGTCTTAGGGGAACAAGG - Intergenic
1195552656 X:106186117-106186139 AAATTTGTCTGACAGGCGTTAGG + Intronic
1195617217 X:106921820-106921842 GAATTTGTCTTCTGGGCATAGGG - Intronic
1196127618 X:112115829-112115851 AAGTTTGTCTGACAGGCATTAGG + Intergenic
1196287010 X:113894453-113894475 GAATTTGACTGAGGAGCATAAGG - Intergenic
1196373188 X:115001390-115001412 GAATTTGACTGAAGGGCATAAGG + Intergenic
1196419673 X:115508760-115508782 AAGTTTGTCTGACAGGCATTAGG + Intergenic
1196488721 X:116244399-116244421 AAGTTTGTCTGACAGGCATTAGG - Intergenic
1197088128 X:122503566-122503588 AGATTTGTTAGATGGGCATATGG + Intergenic
1197513135 X:127395928-127395950 AAGTTTGTCTGAAAGGCATTAGG - Intergenic
1197837689 X:130712849-130712871 GAATTCGACTGAGGGGCATAAGG - Intronic
1197932247 X:131707924-131707946 GAATCCGACTGAGGGGCATAAGG - Intergenic
1198601911 X:138293422-138293444 AAATTTTTTGGAGGAGCATATGG - Intergenic
1198757902 X:140000497-140000519 CAATCTGACTGAGGGGCATAAGG + Intergenic
1198957791 X:142150672-142150694 TAATTTGACTGAGGGGCATAAGG - Intergenic
1199009347 X:142740493-142740515 AAATTCGACTGAGCGGCATAAGG - Intergenic
1199347318 X:146756911-146756933 GAATTCGACGGAGGGGCATAAGG + Intergenic
1200476084 Y:3643488-3643510 TAATTTGACTAAGGAGCATAGGG + Intergenic
1200711017 Y:6485138-6485160 AAGTTTGTCTGACAGGCATTAGG - Intergenic
1200801247 Y:7388884-7388906 AAGTTTGTCTGAAAGGCATTAGG + Intergenic
1201022917 Y:9676848-9676870 AAGTTTGTCTGACAGGCATTAGG + Intergenic
1201272178 Y:12265882-12265904 AAGTTTGTCTGACAGGCATTAGG + Intergenic
1201454900 Y:14159195-14159217 AAGTTTGTCTGACAGGCATTAGG - Intergenic
1201530332 Y:14984440-14984462 AAGTTTGTCTGACAGGCATTAGG - Intergenic
1201568819 Y:15392840-15392862 AAGTTTGTCTGAAAGGCATTAGG + Intergenic
1201634956 Y:16112423-16112445 GAATTTGCCTTAGGTGCATAAGG - Intergenic
1201744214 Y:17352943-17352965 AAGTTTGTCTGACAGGCATTAGG + Intergenic
1201910023 Y:19124521-19124543 GAATTTGACTGAGAGGCATAAGG + Intergenic
1202085761 Y:21135094-21135116 GTATTTGTCTGAGGCACATAAGG - Intergenic