ID: 953260752

View in Genome Browser
Species Human (GRCh38)
Location 3:41336796-41336818
Sequence CGCTGTGTATCTGGAGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953260749_953260752 16 Left 953260749 3:41336757-41336779 CCTGGGCAGTCTGGAAGACTGGC 0: 1
1: 0
2: 1
3: 21
4: 195
Right 953260752 3:41336796-41336818 CGCTGTGTATCTGGAGCATATGG 0: 1
1: 0
2: 0
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953260752 Original CRISPR CGCTGTGTATCTGGAGCATA TGG Intronic
901974532 1:12933574-12933596 AGCTGTGTATCTGAAGAATTTGG - Intronic
902010640 1:13268193-13268215 AGCTGTGTATCTGAAGAATTTGG + Intergenic
920070060 1:203296366-203296388 CTCGGTGTATCAGGAGCAAAAGG - Intergenic
920095982 1:203487130-203487152 ATCTGTGTTTCTGGAGCAAAGGG - Exonic
922889368 1:229048303-229048325 CGCTGTGTGTGTGTAGCATCAGG - Intergenic
922951953 1:229565978-229566000 CGGTGAGTATATGGAGCAAAAGG - Intergenic
923026490 1:230208649-230208671 AGCTGTGAATCTGGAGCCAACGG + Intronic
924922545 1:248645747-248645769 AGCTGAGTAACTGGAGCCTAGGG - Intergenic
1065589619 10:27251727-27251749 GGCTGTGTTTCTGGGGCCTATGG - Intergenic
1065907001 10:30264327-30264349 AGCTGTGGATCTGTAGTATATGG - Intergenic
1069516330 10:69080519-69080541 CGGTGTGTGTCTGGAGGAGAAGG + Intergenic
1071877732 10:89861073-89861095 TTCTGTATGTCTGGAGCATAAGG + Intergenic
1078600933 11:12729923-12729945 CGCTGTGAATCTGCAGCGTGTGG - Intronic
1079184394 11:18223007-18223029 TGCTGTGTGTATGGAGTATATGG + Intronic
1086528478 11:87756533-87756555 CATAGTGTATCTGGAACATATGG - Intergenic
1088976855 11:114823403-114823425 GGCAGTGTAGCTGGAGCATGGGG - Intergenic
1089948375 11:122501621-122501643 AGGTGTATATCTGGATCATATGG + Intergenic
1095383266 12:41619389-41619411 CAGTGTGACTCTGGAGCATAAGG + Intergenic
1097692668 12:62747854-62747876 TGTTGTGTATCTAGAGCAGAGGG - Intronic
1098383539 12:69895082-69895104 TGCTGGGTATATGGAGCATATGG + Intronic
1104528729 12:129549011-129549033 CACTGTGTGTCTGGAGGAAATGG - Intronic
1111568445 13:90047544-90047566 CCCTGTGTTTCTGCAGGATATGG + Intergenic
1116436644 14:44902019-44902041 GGCTGTTTTTCTGGACCATAGGG - Intronic
1119373687 14:74170131-74170153 TCCTGTGTAGCAGGAGCATATGG + Intronic
1121340155 14:93100218-93100240 CCCTGTGGACCTGGAGCATGAGG + Intronic
1122030798 14:98910194-98910216 CTCTGTGTTTCAGGAGCACAAGG + Intergenic
1122400805 14:101466200-101466222 CGGTGTGTGCCTGGAGCATGTGG - Intergenic
1124105776 15:26736665-26736687 GACAGTGGATCTGGAGCATAGGG + Intronic
1124858634 15:33415449-33415471 TGCTGAGTATGTGGAACATATGG - Intronic
1136547991 16:30966066-30966088 CCCTGTGCATATAGAGCATACGG - Exonic
1150862420 17:68814883-68814905 AGCTGATTATCTGGAGCATATGG + Intergenic
1151263025 17:72931551-72931573 CTCTGTCTATCTGGTGCATTTGG - Intronic
1151499645 17:74480618-74480640 CCCTGTGCATCTGGGGCTTAGGG - Intronic
1153936572 18:9931277-9931299 AACTTTGTATCTAGAGCATATGG + Intronic
1155477709 18:26250872-26250894 AGCTGTGTAAATGGAGGATAGGG + Intronic
1156877470 18:42032244-42032266 CCCAGTGTATTTGGAGCAGAGGG + Intronic
1158172924 18:54619608-54619630 CCCTGTGTGTCTGCAGCATCTGG - Intergenic
1160663136 19:310661-310683 GGCTGTGTTTCTGGAGCTTCGGG - Intronic
1162495700 19:11022204-11022226 CACTCTGCACCTGGAGCATAGGG - Intronic
1162910053 19:13843463-13843485 CGCTGTGGAACTGGAGCAAGTGG - Intergenic
1163018156 19:14469470-14469492 CGCTGTGGATGTGCAGCATCAGG - Exonic
1165424101 19:35736532-35736554 CACTGGGTAACTGGAGCAGAAGG + Intronic
1168363058 19:55759288-55759310 CACTGTATTTCTGGAGGATAAGG + Intronic
925359336 2:3266715-3266737 CACTGTGTCTCTGGAGCTCACGG - Intronic
931472671 2:62554817-62554839 TGCTGAGTATCAGCAGCATAAGG + Intergenic
932039462 2:68283829-68283851 CTCTGTGTGGCTGGAGCATAGGG - Intergenic
933713153 2:85342462-85342484 CCCTGTGTATTTGGTGGATAAGG + Exonic
942078093 2:172375313-172375335 CACTGAATATCTGGAGCAAAAGG + Intergenic
945584478 2:211641687-211641709 AGCTTTGCATCTGGAACATAAGG - Intronic
946459519 2:219856682-219856704 CTCAGTGTAACTGGAGCATAGGG + Intergenic
948230110 2:236343051-236343073 CGCTCTGTGTCAGGAGCACAAGG + Intronic
948775027 2:240282078-240282100 AGCTGTGAGTCTGTAGCATATGG - Intergenic
948985496 2:241520169-241520191 GGCTGTTTATTTGGAGTATATGG + Intergenic
1168811672 20:708872-708894 CGCTGTTTTTCAGGAGCACAGGG - Intergenic
1182468538 22:30532850-30532872 TGCCGTGTCTCTGCAGCATATGG - Exonic
1182909202 22:33966636-33966658 CTCTGTGTATCTGGAGGAAGTGG - Intergenic
1183541990 22:38434729-38434751 CACTGTCTATCTGCAGCACATGG + Intronic
952092109 3:29899871-29899893 AGCTTTTTATCTGGAGAATATGG - Intronic
953260752 3:41336796-41336818 CGCTGTGTATCTGGAGCATATGG + Intronic
954727360 3:52624611-52624633 GGCTGTGTTTCTGTAGCAAAAGG - Intronic
963647399 3:147932527-147932549 CCCTGATTATCTGGAGCATAGGG + Intergenic
970484351 4:16509246-16509268 AGCTGTGGATGTGGAGCTTAGGG + Intronic
976449274 4:85167789-85167811 TGCTGTGTGTTTGGAGCAGAGGG + Intergenic
982810114 4:159814630-159814652 CAGTGTGTATGTGGAGAATAGGG + Intergenic
995248913 5:109966941-109966963 CGCATTGGATCTGGAGAATAAGG - Intergenic
1000111372 5:158111426-158111448 CGCTGTTCTTCTGGAGCTTAGGG + Intergenic
1000210398 5:159102297-159102319 CCCTTTGGACCTGGAGCATAAGG - Intergenic
1005198807 6:23319556-23319578 GGCTGTGTGTCTGGAGCTGAAGG + Intergenic
1016572796 6:145533548-145533570 CACTTTGTGTCTGGAGCATGGGG - Intronic
1019735760 7:2649064-2649086 GCCTGTGTATCTGGATCAAAGGG + Intronic
1024353538 7:48392412-48392434 CTTTGTGTATCTGGAGTAAAAGG + Intronic
1024643378 7:51350454-51350476 CCCTGTGTATCTGGAGTTTCCGG - Intergenic
1030440192 7:109579665-109579687 GACTGTGTTTCTGGAGCCTAGGG - Intergenic
1030865304 7:114695382-114695404 TAGTGTGTATCTGGAGCTTAAGG - Intergenic
1034937993 7:155212023-155212045 AGCTGTGTGCCTGGAGCAGAGGG + Intergenic
1035854381 8:2958604-2958626 TTCTGTGTATCTGCAGCATGAGG + Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1041169853 8:55130425-55130447 GGCTGTGTGCCTGGAGCACAGGG + Intronic
1049391518 8:142373948-142373970 CACTGTGTGTGTGGAGCAAAGGG + Intronic
1052214309 9:25946939-25946961 AGCTGTGGATCTGTAGTATATGG + Intergenic
1059483175 9:114607926-114607948 CTCTGTATTTTTGGAGCATAGGG + Intergenic
1188448601 X:30284727-30284749 CAAAGTGTATCTGGATCATATGG - Intergenic
1194965394 X:100282742-100282764 AGCTGTGGATCTGTAGCATATGG + Intergenic
1198984325 X:142431861-142431883 AGGTGTGTATGGGGAGCATATGG - Intergenic
1201338500 Y:12905518-12905540 CGCTGTGTTCCTTGAGCAGAGGG + Intronic