ID: 953267303

View in Genome Browser
Species Human (GRCh38)
Location 3:41403849-41403871
Sequence GTAAACACACTGATAACTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953267303_953267304 -9 Left 953267303 3:41403849-41403871 CCATGAGTTATCAGTGTGTTTAC 0: 1
1: 0
2: 0
3: 18
4: 198
Right 953267304 3:41403863-41403885 TGTGTTTACTTTTTAAATGTTGG 0: 1
1: 1
2: 11
3: 112
4: 988

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953267303 Original CRISPR GTAAACACACTGATAACTCA TGG (reversed) Intronic
900210330 1:1452435-1452457 GTAAACATACTCATAAAACAGGG + Intronic
900223253 1:1520618-1520640 GTAAACATACTCATAAAACAGGG + Intronic
905432269 1:37932833-37932855 GTAAACACACTGCTTACTTACGG - Intronic
905481276 1:38263827-38263849 GTCTTCACACTGAGAACTCAGGG - Intergenic
905579554 1:39073707-39073729 TTAACCAAAGTGATAACTCATGG + Intergenic
906563005 1:46773453-46773475 TTAACCAAAGTGATAACTCAAGG - Intronic
906563169 1:46775298-46775320 TTAACCAAAGTGATAACTCAAGG + Intronic
908824620 1:68121424-68121446 GACAACACACTGATCTCTCAGGG - Intronic
910130270 1:83896176-83896198 GTAAGCCCACAGATAACACAAGG - Intronic
910389867 1:86730318-86730340 GCACACACACTGATAAATCTTGG + Intronic
910600500 1:89026733-89026755 GTCAACACACTGAGAACAAAAGG + Intergenic
915652701 1:157329622-157329644 TTAACCAAACTGATAACTCAAGG - Intergenic
915812853 1:158934176-158934198 GTAATGACACTGATAACACTGGG - Intronic
916480558 1:165210800-165210822 GTAGACACACTGGCATCTCAGGG + Intronic
916622131 1:166510750-166510772 GTAAAGACACTGAGAAAACAGGG + Intergenic
921348139 1:214208160-214208182 GTAAACACACCTCTAACTGAGGG + Intergenic
921393057 1:214636637-214636659 GTAACCAGACTGATAATTGAAGG + Intronic
922600938 1:226852529-226852551 TTAACCAAAGTGATAACTCAAGG - Intergenic
922992581 1:229927360-229927382 ATCAACACACTGACATCTCAGGG - Intergenic
923372112 1:233325204-233325226 TTAAAAACACTCATAATTCATGG + Intergenic
923377895 1:233383711-233383733 CCAAAGACACTGACAACTCAAGG + Exonic
1063028432 10:2207312-2207334 GAAAACACACTCAAACCTCATGG - Intergenic
1067665213 10:48271742-48271764 CTAAAAACACTGATATCTCAGGG + Intronic
1068170306 10:53384198-53384220 GGAAACACAGTAATATCTCATGG + Intergenic
1069338400 10:67381175-67381197 ATAAAAACACTGAAAAGTCAAGG + Intronic
1070909430 10:80104642-80104664 GTAAACACTCTGCTGACCCAGGG + Intergenic
1071870807 10:89792316-89792338 GTAAGCACTGTGATAACTGATGG + Intergenic
1072096593 10:92187637-92187659 GGAACCACTCTGAAAACTCATGG - Intronic
1074341227 10:112632144-112632166 GTTATCTCAGTGATAACTCAAGG + Intronic
1075466893 10:122658332-122658354 ATAAAGAAACTCATAACTCATGG + Intergenic
1076237983 10:128880570-128880592 GTAGACACAGTGAGAACTCGAGG + Intergenic
1077454298 11:2669068-2669090 GTAAAGACACTGATACGGCAGGG - Intronic
1077853390 11:6097093-6097115 GCAACCACACTGAGATCTCATGG - Intergenic
1078348803 11:10575462-10575484 TTAAAAACACAGAAAACTCATGG - Exonic
1078900226 11:15635184-15635206 ATAATCACACTGATGTCTCAAGG + Intergenic
1080137754 11:28876746-28876768 GTAAACAAACAGATAAATAATGG - Intergenic
1081615631 11:44589368-44589390 TTAAAAACACTGACAATTCAAGG - Intronic
1081932244 11:46879698-46879720 TGAGACACACTGAGAACTCAAGG + Intronic
1082737212 11:56869833-56869855 TTAACCAAAGTGATAACTCAAGG - Intergenic
1083358748 11:62089639-62089661 TTAACCAAAGTGATAACTCAAGG - Intergenic
1086889612 11:92241961-92241983 CTAAAATCACTGCTAACTCAAGG + Intergenic
1087047477 11:93854791-93854813 TTAACCAAAGTGATAACTCAAGG + Intergenic
1087049770 11:93874280-93874302 TTAACCAAAGTGATAACTCAAGG + Intergenic
1088122502 11:106386634-106386656 GTAAACAGACTGAAAACCCCAGG - Intergenic
1088600438 11:111469637-111469659 CTAAAGACAATGATAACCCATGG + Intronic
1088646958 11:111925263-111925285 GTAAACACACTTACAATGCAAGG - Intronic
1088962370 11:114682013-114682035 TTAACCAAAGTGATAACTCAAGG + Intronic
1089242425 11:117093588-117093610 CAAAACACACTGAAAATTCAAGG + Intronic
1093175139 12:15905016-15905038 GTAAGCAGACTAATAACTAATGG - Intergenic
1093708360 12:22300689-22300711 TTAAACAAAATGATAACTCAAGG - Intronic
1095855546 12:46856689-46856711 TTAACCAAAGTGATAACTCAAGG + Intergenic
1098152147 12:67557706-67557728 GAAAACAGACTGATAACTATGGG - Intergenic
1098315685 12:69190718-69190740 TTAACCAAAGTGATAACTCAAGG - Intergenic
1100864629 12:98843797-98843819 GTAAGCTCCCTGATTACTCAAGG + Intronic
1101312223 12:103591770-103591792 TTCAAAACTCTGATAACTCAAGG + Intronic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1106226141 13:27788764-27788786 ATGAACCCACTGATAGCTCAAGG - Intergenic
1106504455 13:30359074-30359096 GTAAACACACTGATCACAAAAGG + Intergenic
1108323798 13:49310391-49310413 GTAGACACACAGATCGCTCAGGG - Exonic
1109894634 13:68668482-68668504 TTAACCAAAGTGATAACTCAAGG - Intergenic
1113500147 13:110766824-110766846 GTAAACACAGTGCAAACTAATGG - Intergenic
1115085463 14:29509739-29509761 GGGAACAGACTGATAACACATGG - Intergenic
1115210262 14:30960395-30960417 ATTAAGACACTGATGACTCAGGG + Intronic
1115402719 14:32981085-32981107 GCAAACTCACTGCTAACTCCTGG - Intronic
1116403249 14:44534895-44534917 GTCAACACACTGAAACCTCAAGG + Intergenic
1118631594 14:67709234-67709256 TTAACCAAAGTGATAACTCAAGG + Intronic
1118871036 14:69742314-69742336 TTAACCAAAGTGATAACTCAAGG + Intronic
1118938605 14:70311568-70311590 TTAACCAAAGTGATAACTCAAGG - Intergenic
1120152542 14:81053547-81053569 GTTAAAACACTGATAACACCAGG + Intronic
1120627231 14:86843313-86843335 GTAAACACAGTGAAAACCCCTGG - Intergenic
1122509624 14:102255938-102255960 GTGAACACAGTGATAAACCAAGG + Intronic
1125177049 15:36835926-36835948 TTAAAAACACTTACAACTCAGGG + Intergenic
1126796839 15:52266467-52266489 GTAATCTCACTGCTAACTGAGGG + Intronic
1133629753 16:7608931-7608953 ATGAACACACTGAGAACTGAAGG - Intronic
1137228097 16:46534614-46534636 CTAGACACAGTGATAACTCTTGG - Intergenic
1137735815 16:50722400-50722422 GTAAAGCCACTGAAAACTCTTGG + Intronic
1140419812 16:74809293-74809315 TTAACCAAAGTGATAACTCAAGG - Intergenic
1140459316 16:75126098-75126120 TTAACCAAAGTGATAACTCAAGG - Intergenic
1140986721 16:80164995-80165017 GTAAACACACTGAATGCTAATGG + Intergenic
1141904950 16:87018489-87018511 GTGAACACACGGTAAACTCAGGG - Intergenic
1148951407 17:51315956-51315978 TTAACCAAACTGATAACTCAAGG - Intergenic
1150290916 17:63981403-63981425 GTAAACACTCTGTTAACTTCAGG - Intergenic
1150715044 17:67565332-67565354 GTATACACACTGAAAAAACATGG - Intronic
1151161981 17:72173725-72173747 GGACACACACTGTTCACTCAGGG + Intergenic
1152028968 17:77830124-77830146 GTAAAAACAATGAAAAATCAGGG - Intergenic
1154507723 18:15059307-15059329 GTTAACACACTGTTTTCTCATGG - Intergenic
1156575918 18:38314899-38314921 GGAAAGACAGTGATAACCCAAGG + Intergenic
1157164962 18:45350370-45350392 ACAAACACACTCATAGCTCAAGG + Intronic
1157912786 18:51634325-51634347 TTAACCAAAGTGATAACTCAAGG - Intergenic
1164955983 19:32385426-32385448 GTAGACACATTGTTAACTTAAGG - Exonic
926295286 2:11564586-11564608 GTAAACACTGTGACTACTCATGG + Intronic
926560179 2:14408170-14408192 CTAATGACACTGAAAACTCAGGG + Intergenic
927099515 2:19777144-19777166 GGAAACACACAGAAAACTCTTGG + Intergenic
931757554 2:65387759-65387781 GTATACACACTGAAAACCTAGGG + Intronic
933252641 2:80046156-80046178 GTAAAGACAGTGATAACACAAGG + Intronic
933307031 2:80613953-80613975 GTAATGGCACTGATATCTCAGGG - Intronic
934529402 2:95075613-95075635 GTAAACACACATGTAACCCATGG - Intergenic
935864921 2:107376800-107376822 GAAAACAAATTGGTAACTCATGG + Intergenic
938750848 2:134328431-134328453 GAAACCAGACTGAAAACTCAAGG - Intronic
940332926 2:152494785-152494807 CTAAACAGGCTGATAACCCAGGG - Intronic
940988025 2:160068361-160068383 TTAACCAAAGTGATAACTCAAGG + Intergenic
941049881 2:160720999-160721021 CTAAACACGCTGAGAACTGAGGG - Intergenic
942261579 2:174170294-174170316 GTAAACAAACTGAAAAGTTAAGG + Intronic
947076589 2:226351617-226351639 GTAAACTCAATGATAAGTCAAGG - Intergenic
1173080950 20:39866954-39866976 GTAAACACACTAATGTCTTAAGG + Intergenic
1173099074 20:40066772-40066794 TTAAACTCACTAATAGCTCATGG - Intergenic
1174900840 20:54498306-54498328 TTAAAAGCACTGATAGCTCAGGG + Intronic
1176790359 21:13312472-13312494 GTTAACACACTGTTTTCTCATGG + Intergenic
1177322160 21:19536555-19536577 GTAGAGACACAGATAACTAAAGG - Intergenic
1177589258 21:23141162-23141184 TTAACCATAGTGATAACTCAAGG + Intergenic
1177989531 21:28020711-28020733 GTTAACACACTGTTTTCTCATGG + Intergenic
1178150111 21:29784850-29784872 ATAAATACACTTATAAATCAGGG + Intronic
1178363481 21:31969180-31969202 GCAAACACACTCACAACACAAGG - Intronic
1179068026 21:38044476-38044498 GGCAGCCCACTGATAACTCAGGG - Intronic
1182696129 22:32200422-32200444 TTACACACACTGAGAACCCAGGG - Intronic
1183052280 22:35272981-35273003 GGAAACACACAGATAACTAAAGG - Intronic
1184291028 22:43498317-43498339 GTAGACATCCTGATAACCCATGG + Exonic
1184917683 22:47583119-47583141 TTAACCAAAGTGATAACTCAAGG - Intergenic
952050927 3:29383816-29383838 CTAAAGACACTGAAAACTTACGG - Intronic
952899705 3:38101928-38101950 GTAAACATTCTGATAATACAAGG - Intronic
953267303 3:41403849-41403871 GTAAACACACTGATAACTCATGG - Intronic
956921948 3:73939240-73939262 GTAAACAGAATGATAAATAATGG - Intergenic
959014894 3:101122665-101122687 GTAAACACAGTGTCATCTCATGG + Intergenic
960451811 3:117819024-117819046 TTAAAGACACTAAAAACTCAGGG + Intergenic
961758587 3:129147485-129147507 CTAAAGACACAGAGAACTCAAGG + Intronic
963896592 3:150692334-150692356 TTAACCAAAGTGATAACTCAAGG - Intronic
964312149 3:155405075-155405097 GCTAACACACTGATAGCTAAGGG - Intronic
964933734 3:162056753-162056775 GTAACCAAACTGAGGACTCAAGG + Intergenic
969533642 4:7742483-7742505 GGAAACCCACAGATAACTAAGGG - Exonic
973245533 4:48007027-48007049 TTAACCAGAGTGATAACTCAAGG + Intronic
975051521 4:69870855-69870877 TTAATCAAAGTGATAACTCAAGG - Intergenic
976413315 4:84742454-84742476 GCAAACACACTGAAAACACTCGG - Intronic
977042602 4:92033121-92033143 TTAACCAAAGTGATAACTCAAGG + Intergenic
978057189 4:104285063-104285085 GTAAAGAAACTAAAAACTCAAGG + Intergenic
979684335 4:123495127-123495149 ATAAACACTCTGATAAATCAGGG + Intergenic
979771154 4:124526194-124526216 GGAAATACACTGAGAAATCAAGG - Intergenic
980135435 4:128854141-128854163 GTTAACTCACTGATAACACAGGG - Intronic
980202239 4:129670724-129670746 GTAATCCCAATGATAACTGATGG + Intergenic
982475744 4:155848177-155848199 TTAACCAAAGTGATAACTCAAGG - Intronic
983809463 4:172041651-172041673 ATAAACACATTGATTACTTATGG + Intronic
984363177 4:178764283-178764305 GTAAACTCACAGATAGGTCATGG + Intergenic
984575862 4:181447379-181447401 GAAAAAACACTGAAAACTTATGG - Intergenic
987908350 5:24108354-24108376 GTATACACACAGAAAAATCAGGG - Intronic
987987972 5:25174454-25174476 ATAAACACACAGATAAATGACGG + Intergenic
992964541 5:81986272-81986294 GTGAACACACAGTTAACTGATGG + Intronic
993389127 5:87296881-87296903 TTAAATACACTGGTAACACAAGG - Intronic
993668037 5:90725182-90725204 GTAAACACACTGTTAAGAGAAGG - Exonic
995588297 5:113672014-113672036 TTAAAAACACTGAAAACACAGGG + Intergenic
995797147 5:115953598-115953620 GTAAACATACTAATAAATGAAGG + Intergenic
996037778 5:118777534-118777556 GTGAACATATTCATAACTCACGG + Intergenic
997207372 5:132057622-132057644 GTAACCACTCTGATTACTGACGG - Intergenic
997699022 5:135883379-135883401 GTAAACTCACTGTGAATTCATGG + Intronic
999358639 5:150962151-150962173 TTAACCAAAGTGATAACTCAAGG - Intergenic
999546399 5:152633287-152633309 TTAAACACAGTGATAACCAAAGG - Intergenic
1001200965 5:169716358-169716380 GTGAAAATACTGAGAACTCATGG + Intronic
1002787665 6:416599-416621 TTAAACACACTGAAAATGCAAGG - Intergenic
1004646227 6:17563816-17563838 TTAATCAAAGTGATAACTCAAGG + Intergenic
1005322831 6:24672177-24672199 TTAACCAAAGTGATAACTCAAGG + Intronic
1005360908 6:25029929-25029951 GAAAACACACTTTTAACTCAAGG + Intronic
1008650897 6:53561033-53561055 TTAACCAAAGTGATAACTCAAGG - Intronic
1008887026 6:56442552-56442574 GTAAAGACACTGCTGAATCATGG - Intergenic
1010909107 6:81531134-81531156 CTAAATACAGTGCTAACTCAAGG + Intronic
1012167108 6:95970895-95970917 AAAAACAGACTTATAACTCAGGG + Intergenic
1014111858 6:117626947-117626969 TTAACCAAAGTGATAACTCAAGG - Intergenic
1014690804 6:124561116-124561138 GTAAACAGAATGATTACTGAGGG + Intronic
1016552994 6:145302794-145302816 GTAAATACATTAATAACCCAAGG + Intergenic
1016968547 6:149741492-149741514 GTAAACACAATGTTAAGTGATGG - Intronic
1018456061 6:163953439-163953461 GTAAAAATAATGATAAATCAAGG - Intergenic
1020238914 7:6377183-6377205 AAAAACAGACTGAAAACTCAAGG - Intronic
1021407024 7:20282888-20282910 GTAAACACATTCATAAAACAGGG + Intergenic
1023639954 7:42247472-42247494 GTAAACATCCTGAGATCTCAGGG + Intergenic
1024705094 7:51948302-51948324 GGAAGCACACTGAAAGCTCAAGG + Intergenic
1024935610 7:54709250-54709272 TTAACCAAAGTGATAACTCAAGG + Intergenic
1025039209 7:55625537-55625559 TTAACCAAAGTGATAACTCAAGG + Intergenic
1029945705 7:104530526-104530548 GTAAACACATTTAGAATTCAAGG + Intronic
1030273608 7:107695927-107695949 GTAAACACCCAGATAACCTAGGG - Exonic
1030782612 7:113620131-113620153 TTAACCAAAGTGATAACTCAAGG + Intergenic
1031111936 7:117621123-117621145 GCAAAAACACAGATTACTCAGGG + Intronic
1034278688 7:149836810-149836832 ATAAAGACATGGATAACTCATGG + Intergenic
1035658140 8:1326877-1326899 GTAAACACAGTGACAATACAGGG + Intergenic
1035919548 8:3662196-3662218 CTAAACCCACTGTTAATTCAAGG - Intronic
1037260050 8:16998843-16998865 ATAAATACAGAGATAACTCATGG + Intronic
1041176605 8:55203409-55203431 GGAAACACAGGGATAGCTCATGG - Intronic
1041297014 8:56367691-56367713 TTAACCAAAGTGATAACTCAAGG + Intergenic
1042357398 8:67843671-67843693 TTAACCAAATTGATAACTCAAGG - Intergenic
1043620282 8:82182262-82182284 GTAAACACACTGAAAACCTAAGG + Intergenic
1043691111 8:83153307-83153329 GTAATAACAATGTTAACTCATGG - Intergenic
1046222421 8:111233344-111233366 TTAACCAAAGTGATAACTCAAGG - Intergenic
1046616381 8:116482088-116482110 ACAAAGACACTGATAATTCATGG + Intergenic
1047876119 8:129139672-129139694 GAAAACCCAGTGATAACTCTGGG - Intergenic
1047876124 8:129139706-129139728 GAAAACCCAATGATAACTCTTGG - Intergenic
1049588700 8:143444498-143444520 GTAAAAACACTAATATATCAAGG + Intronic
1050990323 9:12142636-12142658 TTAACCAAAGTGATAACTCAAGG - Intergenic
1051001887 9:12292239-12292261 GTAAAGACACTGGAAACTCAGGG - Intergenic
1051786208 9:20746546-20746568 GCAAAAACACTGATAAATCTGGG - Intronic
1052237406 9:26228215-26228237 GTAAAAACACAGATCACTTATGG + Intergenic
1054788699 9:69234824-69234846 GTAAACTCACTAATAACTCCAGG - Intronic
1057236005 9:93361082-93361104 TTAACCAAAGTGATAACTCAAGG - Intergenic
1058295820 9:103305169-103305191 GTAAACTCATGGAAAACTCATGG + Intergenic
1059237024 9:112769741-112769763 ATCTACACACTGATAACTCCAGG + Intronic
1187817190 X:23245141-23245163 TTAACCAAAGTGATAACTCAAGG - Intergenic
1188075336 X:25768908-25768930 GTTCACACAAAGATAACTCAAGG + Intergenic
1189205835 X:39238138-39238160 GTTCACACTCTGATGACTCATGG - Intergenic
1190057789 X:47191746-47191768 GAAAAGCCACTGAAAACTCAGGG - Intronic
1190252602 X:48738364-48738386 GGAAACACCCAGATAGCTCAGGG + Intergenic
1190692721 X:52925362-52925384 GTAAACCCTATGATGACTCAAGG + Intergenic
1191593898 X:62921371-62921393 ATAAACACTCTGATAAGACATGG + Intergenic
1191706641 X:64100985-64101007 GAAAAAGCACTGATAACACATGG - Intergenic
1193329367 X:80218424-80218446 GTGAACAGACTTATAACCCAGGG - Intergenic
1194147928 X:90286106-90286128 TTAAACAAAGTGATAACTCAAGG - Intergenic
1194270757 X:91811682-91811704 TTCAGTACACTGATAACTCATGG - Intronic
1194955218 X:100171060-100171082 GAAAGGACACTGATAACTGAAGG + Intergenic
1199100262 X:143791257-143791279 AAAAACACACTGATTACTCTAGG + Intergenic
1199531193 X:148849516-148849538 GCTAAAACACTGGTAACTCAGGG + Intronic
1200494308 Y:3862865-3862887 TTAAACAAAGTGATAACTCAAGG - Intergenic
1200587989 Y:5033115-5033137 TTCAGTACACTGATAACTCATGG - Intronic
1200861060 Y:7993295-7993317 ATAAAGACACTGATCATTCATGG - Intergenic