ID: 953267366

View in Genome Browser
Species Human (GRCh38)
Location 3:41404722-41404744
Sequence GCACATGCACATATGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953267366_953267371 28 Left 953267366 3:41404722-41404744 CCCTGCTGCATATGTGCATGTGC 0: 1
1: 0
2: 1
3: 13
4: 218
Right 953267371 3:41404773-41404795 TTCCTTCATGTGATGCCTTCTGG 0: 1
1: 0
2: 0
3: 10
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953267366 Original CRISPR GCACATGCACATATGCAGCA GGG (reversed) Intronic
900403167 1:2481062-2481084 GCACATACACATATGCACACAGG + Intronic
900522867 1:3114668-3114690 ACACATGCACACATGCACCCGGG + Intronic
901785300 1:11620678-11620700 GGACATGCACGTTTGCAGGAAGG - Intergenic
901848402 1:11999327-11999349 GAAGATGCACTAATGCAGCAGGG - Intronic
902160373 1:14525090-14525112 ACACATGGACATATGTATCAGGG + Intergenic
902238263 1:15071617-15071639 AAATATGCAAATATGCAGCACGG + Intronic
904437334 1:30507352-30507374 ACAGCTGCAGATATGCAGCATGG - Intergenic
905921907 1:41725237-41725259 GGACATGCAGACATGCAGCTGGG + Intronic
908423071 1:63978830-63978852 GCTCATGCACTTATGGAGCCTGG + Intronic
911506801 1:98762937-98762959 GCACATGAAAAGATGCATCAGGG - Intergenic
917476408 1:175373065-175373087 AAACATGCACAGAAGCAGCATGG + Intronic
918142688 1:181732447-181732469 GCACATGCAGATGTCCAGCCAGG + Exonic
919742960 1:200991601-200991623 GCACGCACACATGTGCAGCAGGG + Intronic
920355563 1:205369429-205369451 GCACACCCACCTCTGCAGCATGG - Intergenic
920668360 1:207983316-207983338 ACACATGCATGCATGCAGCAGGG + Intergenic
924507828 1:244702793-244702815 GCACATGGATATATGGAGGAGGG + Intronic
1063106893 10:2999882-2999904 ACACACACACACATGCAGCATGG + Intergenic
1063599952 10:7471895-7471917 ACACATACACACATACAGCATGG + Intergenic
1064156967 10:12910248-12910270 GCACAACCACATTTGAAGCAAGG - Intronic
1064943422 10:20760395-20760417 GCACATCCACAGATTCAGCTGGG - Intergenic
1067215667 10:44300607-44300629 GCACATGCACATCAGCTGCCGGG - Intergenic
1069235093 10:66061215-66061237 GCACAGTTACAAATGCAGCAAGG - Intronic
1069485563 10:68820581-68820603 GAAAATGTACATATGCACCATGG - Intergenic
1070554341 10:77516362-77516384 GCACAAGCACAAATGAAACAGGG - Intronic
1070835762 10:79445892-79445914 GCTCATCTGCATATGCAGCACGG + Intergenic
1071525813 10:86357561-86357583 ACACGTGCACATATGCATGAGGG - Intronic
1073467684 10:103703846-103703868 ACACATGCACACACGCACCATGG - Intronic
1073600934 10:104845575-104845597 TCACATGCACCTCTGCAGCAAGG - Intronic
1074040482 10:109783609-109783631 CCACATGGACATTTGCAACATGG - Intergenic
1075188079 10:120281375-120281397 GGAAATGCACATATACACCATGG + Intergenic
1075272163 10:121061726-121061748 CCACAAGCACATGTGCAGGAGGG + Intergenic
1075388505 10:122075308-122075330 GCACCTGCACTGATGCAGCTTGG - Intronic
1075468428 10:122669975-122669997 CCACATGCACATGTGCCTCAGGG + Intergenic
1076183990 10:128432267-128432289 CCACATGCACACAGGCAGCTGGG + Intergenic
1076194141 10:128503330-128503352 GCACTTGCACAAAAGAAGCACGG - Intergenic
1076743278 10:132498788-132498810 GCACATGCACACACACACCAGGG + Intergenic
1077770380 11:5211737-5211759 GAACATGTACATATACACCATGG - Intergenic
1078159041 11:8824560-8824582 GAAAATGTACATATACAGCATGG - Intronic
1078312889 11:10264003-10264025 GCACATTCACATAAGCACCTTGG - Intronic
1078560919 11:12371719-12371741 GAAAATGCACATATACACCATGG + Intergenic
1080395033 11:31882396-31882418 TCACATGCAAATATCCAGGAAGG + Intronic
1080752400 11:35162839-35162861 GAGCATGCACATAAGAAGCAGGG - Intronic
1082586213 11:54944356-54944378 TCAAATGCACATTTGCAGAATGG + Intergenic
1082703845 11:56468049-56468071 GAAAATGCACATATACATCATGG + Intergenic
1086954951 11:92926002-92926024 TCACAGGCTCATAGGCAGCAGGG + Intergenic
1088940511 11:114450190-114450212 GCAAATGCATATATGTACCAAGG - Exonic
1090648545 11:128786616-128786638 ACACACGCACATCTGCAGCCTGG - Intronic
1091009863 11:131990279-131990301 ACACACTTACATATGCAGCATGG - Intronic
1091218191 11:133916413-133916435 ACACATGCAAAGGTGCAGCATGG + Intronic
1092567094 12:9678016-9678038 GGAAATGCACAGATCCAGCAGGG - Intronic
1098073690 12:66703250-66703272 GCACATGTGCACATGCAGCAGGG + Intronic
1099032832 12:77549579-77549601 GTTCATGGACAGATGCAGCAGGG + Intergenic
1101896058 12:108757795-108757817 GCACATCACCATATGCAGCTGGG + Intergenic
1102561189 12:113763267-113763289 ACACATGCACACATGCACAAGGG - Intergenic
1102576611 12:113859844-113859866 GCACACACACATATGCACGATGG + Intronic
1103742458 12:123100034-123100056 CCACATGACCATATGCAGTAAGG + Intronic
1104199145 12:126570604-126570626 ACATATGAACATATGCTGCATGG + Intergenic
1106809846 13:33349508-33349530 GAGCATGCACAGAAGCAGCAAGG + Intronic
1107322749 13:39206675-39206697 GCACATATACATATACACCATGG - Intergenic
1107411305 13:40161026-40161048 CCACATGCACACATACACCATGG - Intergenic
1107564359 13:41586779-41586801 GCACGTGCAGATATGCATGAAGG - Intronic
1112724520 13:102287244-102287266 GTACATGCACATTTACAGAACGG - Intronic
1112959156 13:105101256-105101278 TTACATGTACATATGCTGCATGG - Intergenic
1114686539 14:24537362-24537384 GCACATTCACACTGGCAGCAAGG - Intergenic
1118843692 14:69530172-69530194 ACACATGCACATCTGCTGCTAGG + Exonic
1119929859 14:78534948-78534970 GTACATACACATATGCGGAAGGG - Intronic
1120524144 14:85558149-85558171 GCACATGCACATATATTCCAAGG - Intronic
1122141035 14:99663154-99663176 GCACATGCACGTCTGGAGCCAGG - Intronic
1122158356 14:99764698-99764720 GCCCAGGCACAGAAGCAGCAGGG + Intronic
1123913274 15:24992193-24992215 GCACATGAGCATATGTTGCAGGG + Intergenic
1128931491 15:71708616-71708638 TCACATATATATATGCAGCAAGG + Intronic
1129725539 15:77899717-77899739 GCACGTGCACACATGCAACCTGG - Intergenic
1129931174 15:79412271-79412293 GCACATGCACACATGCACACTGG - Intronic
1130778503 15:87009933-87009955 TTACATGCTCATATGCAGAAGGG + Intronic
1136655716 16:31707994-31708016 CCACATGAACATCTGCAGCTTGG - Intergenic
1138656780 16:58496009-58496031 GCTCATCCTCATTTGCAGCATGG - Intronic
1140473704 16:75228362-75228384 GCCCATGTTCATATGCAGAACGG + Intronic
1140581237 16:76233691-76233713 GTAGATGCAGATAGGCAGCAAGG - Intergenic
1147310242 17:39591804-39591826 GCACACACACATATACAGAAGGG - Intergenic
1147326401 17:39671761-39671783 GAACATGCACACAGGCAGCCTGG + Exonic
1149820249 17:59769430-59769452 TCACAAGCAAATCTGCAGCAAGG - Intronic
1150582607 17:66488740-66488762 GCACGTGCACAGATGCTGAAAGG + Intronic
1151409113 17:73909395-73909417 ACACATGCAAATGAGCAGCACGG - Intergenic
1153152907 18:2114921-2114943 GCACATGCACAGCAGCAGCATGG + Intergenic
1154257725 18:12798616-12798638 GAAAATGTACATATACAGCATGG - Intronic
1154382848 18:13868543-13868565 GCACAAGCAAGAATGCAGCACGG + Intergenic
1155867663 18:30985803-30985825 ACACATGCACATATGCAAGCAGG - Intergenic
1161249798 19:3274461-3274483 GCACATGCACACAGGCAGGAAGG - Intronic
1162224101 19:9205367-9205389 CCACATTCACATATGAAACATGG - Intergenic
1164010531 19:21199757-21199779 GGATTTGAACATATGCAGCATGG + Intergenic
1164838169 19:31372045-31372067 ACACAAGCACATACGCAGCCAGG - Intergenic
1165290912 19:34884975-34884997 GCACGTTAACATATGCAGTAAGG + Intergenic
1168583461 19:57574558-57574580 GCACCTTCACATATACATCAAGG + Intronic
925284702 2:2708308-2708330 GCATATGAAAATATGTAGCAAGG - Intergenic
925299559 2:2800877-2800899 GAAAATGCACACATGCACCATGG - Intergenic
925426858 2:3756590-3756612 GCACTTGCACTAATGCAGCGTGG + Intronic
925591488 2:5514341-5514363 GCAAATCCAGAAATGCAGCAAGG + Intergenic
926108636 2:10168173-10168195 GCTCAGCCACATATACAGCAAGG - Intronic
926178656 2:10619990-10620012 GCACACGCACACATGCCCCAAGG + Intronic
927004993 2:18839288-18839310 GCACATGTTCTTATTCAGCAAGG - Intergenic
927963828 2:27257213-27257235 GCACGTGCACAAATGCCGCCCGG + Exonic
930440860 2:51403652-51403674 TCACAGGCTCATATGCAGAAGGG - Intergenic
930611201 2:53545917-53545939 GCACATGAACAGAAGCAGCCAGG + Intronic
931217236 2:60257463-60257485 GAACATCCACATATGCAGAGTGG + Intergenic
931537389 2:63293881-63293903 GCTGATCAACATATGCAGCATGG + Intronic
935372401 2:102360967-102360989 ACACATCCACATTTGCAGAATGG + Intronic
940603650 2:155892548-155892570 TCACTTGCAGATAGGCAGCAAGG + Intergenic
943042128 2:182815997-182816019 GGACATTCACATATGTAGTATGG + Intergenic
943085769 2:183309074-183309096 GCAAATGTACATATGCACCATGG - Intergenic
944088529 2:195877371-195877393 TCACATGCACATATGAATAAAGG + Intronic
945163535 2:206918518-206918540 GCAGATGCACAGATGCATAAGGG - Intergenic
945207830 2:207351012-207351034 ACACACACACATATGTAGCATGG + Intergenic
945344651 2:208698877-208698899 AAACATGCACAGATGAAGCAAGG - Intronic
946713670 2:222531817-222531839 GGGCATGCACATATCTAGCATGG - Intronic
947316404 2:228863994-228864016 TCACATGGCCATGTGCAGCATGG - Intronic
1170608265 20:17890228-17890250 CCACATGCTCTTCTGCAGCATGG + Intergenic
1170696324 20:18662529-18662551 GCACATACACATGTGCAGAAGGG + Intronic
1171041226 20:21765575-21765597 GCAGATGCACTTAAGAAGCAGGG - Intergenic
1171764651 20:29252316-29252338 GCACATGCATATGTCCTGCATGG - Intergenic
1173050854 20:39560269-39560291 GCACTTTAACATATGCAGCCAGG - Intergenic
1173101266 20:40091116-40091138 TCACAGGCACATAAGCAGAAGGG - Intergenic
1174451171 20:50621441-50621463 GCACATGCACACATGCACACGGG + Intronic
1174819238 20:53713020-53713042 GCACGTGCACATTTGGAGCTGGG - Intergenic
1178725559 21:35048390-35048412 GCACATGCACAGAGCCAGCCAGG - Intronic
1179316321 21:40247365-40247387 GCACAGGCTCATAGGCAGAAGGG - Intronic
1180102539 21:45595678-45595700 GCACATGCACACATGCACACAGG - Intergenic
1180245367 21:46543742-46543764 GCACATGCAGAGATGGGGCAAGG - Intronic
1180880438 22:19199610-19199632 GCATCTGCAAATATGAAGCATGG - Intronic
1182347368 22:29675792-29675814 GCACATCCACACACACAGCACGG + Intronic
1182950104 22:34366024-34366046 GTACATACACATATACATCATGG - Intergenic
949441980 3:4091419-4091441 GTACGTGCATCTATGCAGCAAGG + Intronic
951445051 3:22769330-22769352 TCTCATGCTCATAGGCAGCAGGG - Intergenic
952048497 3:29354550-29354572 GCACGTGCACACGTGCACCATGG - Intronic
952692048 3:36220378-36220400 GCTCATGCTCAAATGCAGAAGGG - Intergenic
953267366 3:41404722-41404744 GCACATGCACATATGCAGCAGGG - Intronic
954171385 3:48805510-48805532 GCATATGCCCATAGGTAGCATGG - Intronic
954645945 3:52131621-52131643 GCACATGGACATGTACACCAAGG + Intronic
959347040 3:105209036-105209058 GGACATGCACATGTGCAGAGTGG - Intergenic
959761294 3:109968856-109968878 GTACAGCTACATATGCAGCAAGG + Intergenic
961131187 3:124468503-124468525 GAACATGCACATTTTAAGCAAGG - Intronic
961176763 3:124842079-124842101 GCACATGGACAAATGCTGAATGG + Intronic
966175081 3:177129847-177129869 AAAAATGCACATATCCAGCAGGG + Intronic
966556405 3:181266127-181266149 GCACACGGACGCATGCAGCAAGG - Intergenic
968518733 4:1025914-1025936 ACACATGCAGATATGCTGCCTGG + Exonic
968518751 4:1026231-1026253 ACACATGCAGATATGCTGCCTGG + Exonic
968790623 4:2658725-2658747 GCACAGGGACACATGCAGAATGG - Intronic
969742959 4:9046398-9046420 TTACATGCTCATATGCAGAAGGG + Intergenic
970461361 4:16277731-16277753 TTACAGGCACATAGGCAGCAGGG + Intergenic
971748143 4:30611482-30611504 TCACAGGCTCATATGCAGAAGGG + Intergenic
971868388 4:32203551-32203573 GCATATGCACATATGAGGAAGGG + Intergenic
974296163 4:60001095-60001117 GCACATGCACATCTGTCTCAAGG - Intergenic
974431183 4:61798362-61798384 ACACATGCACATATACAGAGAGG - Intronic
975732360 4:77350132-77350154 GCACATGCCCCTCTGTAGCAGGG + Intronic
976141790 4:82000610-82000632 GGACATGGACATTTGCAGCAGGG + Intronic
976382025 4:84410336-84410358 ACACATGCACACATGCACAATGG + Intergenic
978370895 4:108028902-108028924 GGGCATGCACCTATGCAGAAAGG - Intronic
980038381 4:127911015-127911037 GCTACTGCACATATGCAGCCAGG - Intergenic
981924394 4:150122386-150122408 GCAAATGCACATATACACCATGG + Intronic
983064763 4:163195443-163195465 GCACATGCAGATAAGCAGCACGG - Intergenic
983472881 4:168177933-168177955 GCACAGGATCATTTGCAGCATGG - Exonic
984870478 4:184320340-184320362 ACACATGCACATATGGACCTAGG + Intergenic
985070525 4:186163055-186163077 GCTCAGGCACATCTGAAGCACGG - Intronic
985140699 4:186837653-186837675 GAAAATGCACATATACACCATGG - Intergenic
985703331 5:1386635-1386657 GCACCTGCACTTGCGCAGCAAGG - Intergenic
986169215 5:5302131-5302153 GCACAAGCCCATCTGCAGGAGGG - Intronic
986445455 5:7816880-7816902 GTACATGCACATTGGCACCATGG + Exonic
989017952 5:36962253-36962275 ACACATCCACAGATGCAACAAGG + Exonic
994663134 5:102676880-102676902 GCACATATACATATACACCATGG + Intergenic
995710743 5:115033022-115033044 ACACATGCACATAAGGAGTATGG + Intergenic
997517352 5:134499949-134499971 ACACATGGACATATGGAGCGGGG - Intergenic
997544358 5:134693145-134693167 GTACATGCATATATGCCGTAGGG + Intronic
997854072 5:137357605-137357627 CCACATGCACATATGGGGAACGG + Intronic
1000689686 5:164301078-164301100 GAACATGCTCATATGGAGAAAGG + Intergenic
1003051286 6:2783135-2783157 GCACACGCACAGAGGCAGGAGGG - Intronic
1004328006 6:14694701-14694723 ACACATACATATATGCAGAATGG - Intergenic
1005483594 6:26277874-26277896 GGACTTCAACATATGCAGCAGGG + Intergenic
1006261343 6:32874151-32874173 GAAAATGTACATATGCACCATGG - Intergenic
1006499359 6:34448149-34448171 GCAGGTGCACATAGGCAGAAAGG + Intergenic
1009814242 6:68710481-68710503 GCAAAAGCACATCTGCAGCCAGG - Intronic
1012626363 6:101408346-101408368 ACACATACACACATGCAGCAGGG + Intronic
1014104057 6:117543291-117543313 GCATATGTACAAAAGCAGCATGG + Intronic
1014870641 6:126591864-126591886 GCACTTGTACATTTGAAGCAGGG - Intergenic
1015449812 6:133353295-133353317 ACACATACACATACACAGCATGG - Intronic
1018492982 6:164315815-164315837 GCACTTACAGATAGGCAGCAAGG + Intergenic
1019611073 7:1936930-1936952 GCCCAGGCACACACGCAGCACGG + Intronic
1023331483 7:39122313-39122335 GCACATGCTCTTGTGCAGCCAGG + Intronic
1023862129 7:44223075-44223097 AAACATGCACATAAGCAGGACGG + Intronic
1024497590 7:50066162-50066184 GATTATGAACATATGCAGCATGG + Intronic
1028672396 7:93418079-93418101 TCACATCCACATCTTCAGCAGGG + Intergenic
1029601194 7:101564310-101564332 GCACACGCACATGTATAGCAGGG - Intergenic
1034520581 7:151616282-151616304 ACACATGCACATATGCACACAGG + Intronic
1035550670 8:522071-522093 GCTCATGAACAAATTCAGCAAGG - Intronic
1037376344 8:18233987-18234009 CCACATGCACATTAACAGCAAGG + Intergenic
1037741448 8:21612293-21612315 GCATATCCAGATTTGCAGCATGG + Intergenic
1038230487 8:25694841-25694863 TCACATGCACTTATGCAGTGAGG + Intergenic
1038531253 8:28319608-28319630 ACACATGCACATATGCACACTGG + Intronic
1038991547 8:32873748-32873770 GCATTTGCACAGATGCAGCAGGG + Intergenic
1039010467 8:33087851-33087873 ACACATGCAAATTTGAAGCAAGG - Intergenic
1040883898 8:52238643-52238665 GCACATACATATATACAACATGG + Intronic
1041151726 8:54942758-54942780 GCACATGTAGACATGGAGCATGG - Intergenic
1045018612 8:98021439-98021461 GCATATGCACAAATACAGAATGG + Intronic
1045394672 8:101748979-101749001 GCGCATGCACACATGCTCCAGGG - Intronic
1047861231 8:128969631-128969653 GCTCATGCACATATGGAGTCTGG + Intergenic
1050137354 9:2480389-2480411 GCACGTGTGCACATGCAGCAGGG - Intergenic
1050256738 9:3800423-3800445 GCACATACACATATGCAGGCGGG + Intergenic
1051387995 9:16530870-16530892 GCACAAGCAGCTCTGCAGCAGGG + Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055848665 9:80598224-80598246 GCACATGCACATTCTCTGCATGG + Intergenic
1056356804 9:85808352-85808374 GCTCATGCACATCTGCATTATGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1060179024 9:121519137-121519159 CCACATGCACATTAGGAGCATGG - Intergenic
1060205316 9:121679393-121679415 GTACATGCACAAATGCAGAAGGG - Intronic
1060775411 9:126370212-126370234 GCACATGTCCATATCCAGAAAGG - Intronic
1061971208 9:134046419-134046441 GCACCTGGACAAATGCAGCCTGG - Intronic
1062729195 9:138099561-138099583 ACACAGGCACATACGCACCACGG - Intronic
1185841179 X:3392735-3392757 GAAAATGCACATATACACCATGG + Intergenic
1186018735 X:5229295-5229317 ATATATGTACATATGCAGCAGGG + Intergenic
1186236107 X:7512020-7512042 GCACATGCACACATGCACAGAGG - Intergenic
1186250216 X:7657634-7657656 GCACATGCACATGGTCACCAAGG + Intergenic
1186504584 X:10081018-10081040 GCACATGCGCAAGTTCAGCAAGG - Intronic
1190429504 X:50365581-50365603 GCCCCTGCAAATAAGCAGCAGGG - Exonic
1190955468 X:55188657-55188679 GCAAAGGGAGATATGCAGCATGG + Intronic
1191015012 X:55799859-55799881 GCCCATGAACATATGCAAAATGG + Intergenic
1191268905 X:58436002-58436024 CCAAATGTACATTTGCAGCATGG + Intergenic
1192208363 X:69110748-69110770 ACACATGCACATATGCATGCAGG + Intergenic
1192742552 X:73907268-73907290 GAAAATGCACATATACACCATGG - Intergenic
1193483785 X:82060437-82060459 GCACATTCACACAGGCAGCAGGG - Intergenic
1196979854 X:121200261-121200283 ACACATACACATATACACCATGG - Intergenic
1198892026 X:141407646-141407668 GCCAATGAACATTTGCAGCAAGG + Intergenic
1199673775 X:150167321-150167343 GCAATTGCACAGATGCATCATGG - Intergenic