ID: 953268476

View in Genome Browser
Species Human (GRCh38)
Location 3:41416391-41416413
Sequence GACCCAGGAGAGTCCCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 2, 2: 2, 3: 19, 4: 255}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953268476_953268484 30 Left 953268476 3:41416391-41416413 CCTGGCAGGGACTCTCCTGGGTC 0: 1
1: 2
2: 2
3: 19
4: 255
Right 953268484 3:41416444-41416466 TGACGCCGTCATGTAACAAAAGG 0: 1
1: 0
2: 0
3: 0
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953268476 Original CRISPR GACCCAGGAGAGTCCCTGCC AGG (reversed) Intronic
900130512 1:1085283-1085305 GCCCCCGCAGGGTCCCTGCCAGG - Intronic
900150419 1:1176579-1176601 GGCCCAGGAGGCTCCCAGCCGGG - Intronic
900637927 1:3674911-3674933 AACCCAGAAGAGCCCCCGCCTGG - Intronic
900786311 1:4652902-4652924 GACTCAGCAGTTTCCCTGCCGGG - Intergenic
901026299 1:6280407-6280429 GACCCTACAGAGTCCATGCCAGG + Intronic
901226001 1:7613392-7613414 CACACAGGAGAGGCCCAGCCTGG + Intronic
901631773 1:10651523-10651545 GACACAGCAGAGGCCCTTCCTGG - Intronic
901642244 1:10698677-10698699 GGCCAAGGAGGGTCCCTGGCAGG + Intronic
901858696 1:12060388-12060410 GACCCAGGGGAGCCACTGCAGGG + Intergenic
903905466 1:26682822-26682844 GACCCAGGAGATTCACAGACTGG + Intergenic
905907544 1:41629003-41629025 GACACAGAACAATCCCTGCCTGG + Intronic
907792580 1:57681930-57681952 GCCCCAGTAAAGTCCCTGCTTGG + Intronic
909392186 1:75131191-75131213 GACCCAGGCGAGTCCCTAGAAGG + Intronic
909529999 1:76671375-76671397 CACCCAGCAGAGTGCCTGACAGG + Intergenic
913516584 1:119610470-119610492 AACCCAGGAGAATCCCTGAGGGG + Intergenic
914667544 1:149843408-149843430 GCTCCAAGTGAGTCCCTGCCGGG + Intronic
914668223 1:149850382-149850404 GCTCCAAGTGAGTCCCTGCCGGG - Intronic
914672990 1:149886248-149886270 GCTCCAAGTGAGTCCCTGCCGGG - Exonic
915954322 1:160209923-160209945 GGCCCAGCAGTGGCCCTGCCAGG - Intronic
917640110 1:176975207-176975229 CACCAAGTAGAGTACCTGCCTGG - Intronic
918110160 1:181448770-181448792 CACCCAGGGGAGGCCCTGCAGGG - Intronic
918163041 1:181919151-181919173 GACCCAGCAGATTTCCAGCCAGG - Intergenic
922553181 1:226512407-226512429 GAGCCAGGAGGGTCCCTATCTGG + Intergenic
922653053 1:227357525-227357547 GCCCAAGGACATTCCCTGCCTGG - Intergenic
922797449 1:228347499-228347521 GAACCAGCAAAGTCCCTGGCAGG + Intronic
924498557 1:244614033-244614055 GACCCTGCAGAGTCCCCACCAGG + Intronic
1063456388 10:6185558-6185580 GACCCAGATGAGCCCCTGGCTGG - Intronic
1064003849 10:11684782-11684804 GACCCGGGAGTGGCCCTGCCTGG + Intergenic
1066300343 10:34090427-34090449 GACCCTGAAGAGTCCCTGGCGGG - Intergenic
1066961877 10:42232900-42232922 GACCAAGGAGAGTCCATTGCAGG + Intergenic
1067695990 10:48536025-48536047 GACCCAGGCCAGCCTCTGCCGGG - Intronic
1069582157 10:69573465-69573487 GGGCCAGGAGCGTGCCTGCCCGG + Intergenic
1070411855 10:76149339-76149361 GAATCAGGAGAGTCAGTGCCTGG + Intronic
1074865461 10:117542254-117542276 GTCCCTGCAGAGTCCCTGGCCGG - Intergenic
1075580179 10:123611651-123611673 GACCCAGGAAAGGCTCTGGCTGG + Intergenic
1075594531 10:123718774-123718796 AACCCAGGAGAGCCCCTGCATGG - Intronic
1076763475 10:132617203-132617225 GAGCCAGGACAGACCCTGCTTGG + Intronic
1076776475 10:132700610-132700632 GAGCCATGGGAGTCCCGGCCTGG + Intronic
1076898392 10:133325291-133325313 GACCCAGGAGAGACCCCGTGGGG - Intronic
1077234086 11:1471537-1471559 GACCCAGGTGTCTCCCTCCCTGG + Intronic
1077486971 11:2843434-2843456 GGCCCTGGGGAGGCCCTGCCTGG + Intronic
1079375197 11:19886317-19886339 GACCCAGGTCAGGCTCTGCCTGG + Intronic
1080596334 11:33777131-33777153 GACCCAGGAGAGCCCTTTCCTGG + Intergenic
1081906836 11:46675577-46675599 CACTCAGCAGAGGCCCTGCCAGG + Intergenic
1082783233 11:57302625-57302647 GAGGGTGGAGAGTCCCTGCCAGG + Exonic
1083440392 11:62672216-62672238 GACCCCGGAGAGTCCTGGCATGG - Exonic
1083585548 11:63856153-63856175 GCCCCAGTATAATCCCTGCCTGG + Intronic
1083705424 11:64510928-64510950 GACCCTGGAGAGGCACCGCCTGG + Intergenic
1083946438 11:65925687-65925709 AACCCAGGAGTGGACCTGCCAGG - Intergenic
1084582824 11:70034879-70034901 GACTAAGCAGAGTCCCTGCTGGG - Intergenic
1085408296 11:76277038-76277060 AACCCAGGACAGGGCCTGCCAGG - Intergenic
1089129272 11:116199421-116199443 GACCCAGCTGCTTCCCTGCCAGG - Intergenic
1089368419 11:117935231-117935253 GACCCATGCTTGTCCCTGCCAGG - Intergenic
1089388732 11:118085699-118085721 AACCCATGAGGGTCCCTGCCAGG + Intronic
1089788168 11:120923008-120923030 GATCCAGGAGACACCCTGCACGG + Intronic
1090300043 11:125627105-125627127 GACTCTGGAGATTGCCTGCCTGG + Intronic
1090939579 11:131375218-131375240 CACCCAGGGGAGTCGCTCCCCGG - Intronic
1090943498 11:131409482-131409504 GTCTCAGTAGAGTCCTTGCCCGG - Intronic
1091699912 12:2652586-2652608 CACCCTGGCCAGTCCCTGCCCGG + Intronic
1095670671 12:44856618-44856640 GCAGCAGGAGAGTACCTGCCTGG + Intronic
1096234128 12:49914246-49914268 GAGCCAGGAGGCTCCCTGCACGG + Intergenic
1099028123 12:77491539-77491561 GACCCAGCATTGTGCCTGCCTGG + Intergenic
1102028244 12:109725611-109725633 GACCCAGGTGAGACCAGGCCAGG + Intronic
1103964758 12:124631812-124631834 GTCCCTGGGGAGTCCCTGCTGGG - Intergenic
1104269755 12:127272541-127272563 GTCCCAGGAGAGTCCATGGTGGG - Intergenic
1107556094 13:41517790-41517812 GACCCAGGAGTGTCTCTTCCTGG - Intergenic
1109994544 13:70107287-70107309 GGTCCAGGAAAGTCCATGCCTGG + Exonic
1112792328 13:103016599-103016621 GACCCAGGAGTCTCCGTGGCAGG - Intergenic
1113594488 13:111521402-111521424 CACCCAGGAGATTACCTACCTGG - Intergenic
1113763665 13:112867529-112867551 GACGCTGCAGAGACCCTGCCAGG - Intronic
1113876716 13:113599282-113599304 GACCTGGGTGACTCCCTGCCGGG + Intronic
1114643134 14:24238010-24238032 GCCTCTGGAGAGTCCCTGCCTGG - Intronic
1115089503 14:29556998-29557020 GGCCCAGAAAGGTCCCTGCCTGG - Intergenic
1115232717 14:31178704-31178726 GAGGCAGGAGAATCCCTTCCGGG + Intronic
1118163724 14:63316021-63316043 GAACAGGGAGAGGCCCTGCCAGG + Intronic
1118717238 14:68569163-68569185 CACCCGGGAAAGTCCCTGCAGGG + Intronic
1120087038 14:80286545-80286567 AAGCGAGGAGAGTCTCTGCCCGG + Intronic
1122115664 14:99526125-99526147 GACCCAGGAGAGTCTGGGCTGGG - Intronic
1122691407 14:103533612-103533634 GCCCCAGGGGAGGCTCTGCCGGG - Intronic
1122830604 14:104393792-104393814 GACCCTGGAGAGACCTGGCCAGG + Intergenic
1122967961 14:105140047-105140069 GCCTCAGGACAGCCCCTGCCAGG + Intergenic
1123000177 14:105289479-105289501 GACTCAGGAGAGACCCATCCTGG + Intronic
1123037178 14:105476213-105476235 GACCCTGGAGAGCCCCAGGCTGG - Intronic
1124347677 15:28933395-28933417 GAGCCAGCAGATTCCGTGCCTGG - Intronic
1126794930 15:52252843-52252865 GCCCCATGAGAGACACTGCCAGG + Intronic
1127161571 15:56192642-56192664 AACCCAGGAGTGTCCTTGCAAGG + Intronic
1127771107 15:62231542-62231564 GTACCAGGAGAGGCCATGCCTGG - Intergenic
1127959095 15:63877880-63877902 GCCCCAAGAGAACCCCTGCCTGG - Intergenic
1128320415 15:66689922-66689944 CACCCAGTAAAGTGCCTGCCAGG - Intergenic
1130093231 15:80838290-80838312 GGGCCAGCAGGGTCCCTGCCAGG - Intronic
1131092426 15:89632804-89632826 CAGCCAGGTGAGGCCCTGCCAGG - Exonic
1132559391 16:586455-586477 TACTCAGGAGTGTCCCTGGCTGG + Intergenic
1132565271 16:619615-619637 GAGCCAGGAGAGCCCCTCCGGGG + Intronic
1132702992 16:1229875-1229897 GCCCCTGGTGAGTCCCAGCCGGG - Exonic
1132705331 16:1240993-1241015 GCCCCTGGTGAGTCCCAGCCGGG + Exonic
1132708462 16:1256356-1256378 GCCCCTGGTGAGTCCCAGCCGGG + Exonic
1132874638 16:2130914-2130936 GACCCAGGTGACCCCCAGCCAGG + Intronic
1133019223 16:2959534-2959556 ATCCCTGGAAAGTCCCTGCCAGG - Intergenic
1133236610 16:4390195-4390217 GACCCAGGAGAGCCCCAGCCTGG + Intronic
1134207477 16:12249933-12249955 GATACAGGAGAATCCCTTCCTGG + Intronic
1134553580 16:15149747-15149769 GACCCAGGTGACCCCCAGCCAGG + Intergenic
1134771439 16:16812717-16812739 GACCATGGGGAGTCCCTGCTGGG + Intergenic
1135302645 16:21344359-21344381 GAGCGAGGAGAGTTGCTGCCAGG + Intergenic
1136286458 16:29246969-29246991 GACTCAGCAGAGTACCTGGCTGG - Intergenic
1137499926 16:49003046-49003068 GACCCAGCAGAAGCCCTCCCAGG + Intergenic
1137792593 16:51187409-51187431 GCCCCAGGAGAACCCCTCCCAGG - Intergenic
1139300783 16:65943577-65943599 GACCCAGGAGAGGGCATGGCTGG - Intergenic
1142091813 16:88217267-88217289 GACTCAGCAGAGTACCTGGCTGG - Intergenic
1142140133 16:88469098-88469120 GCCCCAGGGCCGTCCCTGCCGGG - Intronic
1143025150 17:3937280-3937302 GACCCTGGAAAGCCCCAGCCAGG + Intronic
1143633773 17:8152877-8152899 AACCCAGGAGAGGCCCAGGCAGG - Intronic
1144779026 17:17798723-17798745 GTCCCAGGAGACTTCCCGCCGGG + Intronic
1144877975 17:18412240-18412262 GACCCAGGAGAGTCGCTGCCAGG + Intergenic
1145154254 17:20532185-20532207 GACCCAGGAGAGTCGCTGCCAGG - Intergenic
1145346424 17:22044716-22044738 GACCCAGCAGAGCCCGAGCCCGG + Intergenic
1145841721 17:28000610-28000632 GTCCCAGGAGAGTCCCTGAAGGG + Intergenic
1146026915 17:29329562-29329584 GAGGCAGGAGAATCACTGCCAGG + Intergenic
1146100420 17:29975350-29975372 GAGGCAGGAGAATCGCTGCCGGG - Intronic
1146661062 17:34665484-34665506 GAGCCATGAGAGTCCCCACCAGG + Intergenic
1147947505 17:44088320-44088342 GACACAGGAGAGTACCAGGCTGG - Intronic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1149056779 17:52376275-52376297 GTCCCAGGAGAATCTCTGACTGG + Intergenic
1149350678 17:55783865-55783887 GTCCCTGGAGAGCGCCTGCCAGG + Intronic
1150296065 17:64008152-64008174 GACCCAGGGAAGTCCCTGGACGG + Intronic
1151147790 17:72057443-72057465 GATCCAGGTGAGTAGCTGCCTGG - Intergenic
1151414461 17:73952538-73952560 GACCCAGGAGCCTCCTGGCCTGG - Intergenic
1151419097 17:73985681-73985703 CACCCAGGAAGGTCCCTGGCTGG - Intergenic
1152180537 17:78818251-78818273 GAACCCTGAAAGTCCCTGCCAGG + Intronic
1152227564 17:79099549-79099571 GACCCAGAAGAGTCACTGGATGG - Intronic
1152259105 17:79257166-79257188 GCCCCAGGACAGTCACTTCCCGG - Intronic
1152605081 17:81285587-81285609 GACTCAGCAGGGTCCCTCCCAGG + Intronic
1154295320 18:13142166-13142188 GTCCCTGGTGAGTCTCTGCCAGG + Intergenic
1155521309 18:26671708-26671730 GACCCATGAGAGTCATTGCTGGG + Intergenic
1160544180 18:79641920-79641942 GACCCAGCCGAGACCCTGCAGGG + Intergenic
1161544623 19:4872797-4872819 GTCCCAGATGGGTCCCTGCCTGG + Intergenic
1162301341 19:9846888-9846910 GTCCCTGGAGAGTGGCTGCCAGG + Intronic
1162577029 19:11505318-11505340 GAGCCAGGCGCGTCCCGGCCAGG + Intronic
1162589091 19:11578967-11578989 GACCCAGGTGAGCCCCGGCGGGG + Exonic
1163556617 19:17997044-17997066 CACCCAGGACTGTCCCTGCCTGG + Intronic
1164673308 19:30085500-30085522 GGCCCAGGAGAGTGACAGCCGGG + Intergenic
1165153985 19:33776711-33776733 GCCCCAGGGAAGTCCCTGCCAGG + Intergenic
1165382977 19:35494257-35494279 GACCCAGGAGGCTGGCTGCCAGG - Intronic
925420529 2:3706987-3707009 CACCCATGAGAATCCGTGCCAGG - Intronic
925834027 2:7925579-7925601 GACCCAGGATAGCCCTTCCCAGG + Intergenic
926808334 2:16733762-16733784 CAGCCAGGAGAGTCTCAGCCAGG - Intergenic
932335993 2:70931703-70931725 GACCCTGGAGAGGCCCAGGCAGG - Intronic
933948617 2:87309088-87309110 GTCCCAGGAGAGGCCCACCCAGG - Intergenic
936331582 2:111552508-111552530 GTCCCAGGAGAGGCCCACCCAGG + Intergenic
937869828 2:126778870-126778892 GTCCCAGGTGAGGCCCAGCCTGG - Intergenic
937936278 2:127248160-127248182 GAGCCAGGAGATTTTCTGCCAGG - Intergenic
941007523 2:160263064-160263086 GACCCATGATAGCCACTGCCAGG + Intronic
944423612 2:199557009-199557031 GACACAGCAGAGACCCTGCAGGG - Intergenic
946157762 2:217818203-217818225 CACCCCGGGGAGTCCCAGCCTGG - Exonic
946230218 2:218286678-218286700 CCCCCAGGAGAGCCCCAGCCGGG - Exonic
946399429 2:219460817-219460839 GACCCAGCTGAGGCCCTGCACGG - Intronic
947214272 2:227735944-227735966 GACTCAGGTGGCTCCCTGCCTGG + Intergenic
947633113 2:231666351-231666373 GCCTCAGGGGACTCCCTGCCTGG - Intergenic
948867365 2:240782752-240782774 GGCCCTGGAGGGACCCTGCCTGG - Intronic
1169226826 20:3862118-3862140 GAGCCAGGGGAGCCCTTGCCTGG - Intronic
1169636145 20:7693973-7693995 GACCCAGGCCATTCTCTGCCTGG + Intergenic
1171521136 20:25774818-25774840 GACCCAGCAGAGCCCGAGCCCGG - Exonic
1171555787 20:26081660-26081682 GACCCAGCAGAGCCCGAGCCCGG + Intergenic
1172364025 20:34335051-34335073 GACCCAGGCCAGACCCAGCCAGG - Intergenic
1174199559 20:48797833-48797855 GGCCCAGGAGAGTCGATGACAGG + Intronic
1174538484 20:51271101-51271123 GACCCTGCAAAGGCCCTGCCTGG + Intergenic
1175143414 20:56877850-56877872 GACCCAGCACAGTGCCTGGCAGG - Intergenic
1175899262 20:62353607-62353629 CACCCTGGCCAGTCCCTGCCTGG - Intronic
1176170459 20:63694228-63694250 CACCCAGGCGTGTACCTGCCTGG + Intronic
1176275323 20:64262852-64262874 GACCTAGGAGCGGCTCTGCCAGG + Intronic
1179008099 21:37531861-37531883 GGCCCAGGATTGTCGCTGCCAGG - Intergenic
1179545746 21:42111346-42111368 CAGCCAGGAGAGCCCCAGCCAGG + Exonic
1179933263 21:44586072-44586094 GGCCCAGGAGGCTCCCAGCCTGG - Intronic
1180023728 21:45146447-45146469 GCCCCGGGAGAGTCCCGGTCCGG - Intronic
1182088653 22:27579188-27579210 AAGCCAGGAGAATCCCTGCCTGG + Intergenic
1182713720 22:32338817-32338839 GACTCAGGAATCTCCCTGCCTGG + Intergenic
1183484428 22:38081707-38081729 GTCCCCGGAGAGCCCCTCCCTGG + Intronic
1183619310 22:38963522-38963544 GACCCAGGACAGGCCCAGTCGGG + Intronic
1183624457 22:38993117-38993139 GACCCAGGACAGACCCAGTCGGG + Intergenic
1183640201 22:39088133-39088155 GACCCAGGACAGGCCCAGTCAGG + Intergenic
1183675912 22:39298746-39298768 GGGCCAGGTGAGTCCCTGCCAGG + Intergenic
1184282078 22:43443009-43443031 GGCACAGGATTGTCCCTGCCTGG + Intronic
1184401006 22:44274398-44274420 GACTCAGGAATCTCCCTGCCTGG + Intronic
1185267159 22:49910374-49910396 GACTCAGGGGAGCCCCTGCCCGG + Intronic
1185339835 22:50286339-50286361 GCCCCAGGGGAGGCCCAGCCTGG - Intronic
953268476 3:41416391-41416413 GACCCAGGAGAGTCCCTGCCAGG - Intronic
953904740 3:46862891-46862913 GAACAAGGAAAATCCCTGCCTGG + Intronic
953963199 3:47282501-47282523 GTCCCGGGAGCGTCGCTGCCTGG - Exonic
954133437 3:48571213-48571235 TACCCAGAAGGGTCCCTGCTGGG - Intronic
954773783 3:52998553-52998575 GACCCTGGAGGGACCCTGCGAGG - Intronic
954784174 3:53081054-53081076 GACACAGGCGAGTGCCTCCCTGG + Intronic
955411281 3:58657214-58657236 GAGCCAGGAGAGTCGGTGGCCGG + Intronic
955429109 3:58823588-58823610 AACCCAGGATCGTGCCTGCCAGG + Intronic
959460807 3:106623278-106623300 CACCCCAGAGAGTCCCTGACAGG - Intergenic
959503794 3:107136075-107136097 GACCAAAGAGAGCCCCTGCTGGG + Intergenic
961200699 3:125043246-125043268 GACCCAGGGGAGGCCTGGCCTGG + Intronic
961739068 3:129021091-129021113 GACACATGAGGGGCCCTGCCAGG + Intronic
965725563 3:171711630-171711652 GAAGCAAGAGAGTCCCTTCCTGG - Intronic
968601798 4:1513112-1513134 GCCCCAGGAGGGTCCCAGCACGG + Intergenic
968614554 4:1571477-1571499 AGCCCAGGTGAGGCCCTGCCTGG - Intergenic
968631881 4:1656101-1656123 GGCCCTGGAGAGTCCTGGCCGGG - Intronic
969486564 4:7475475-7475497 GCCACAGGAGTGTCCCAGCCTGG + Intronic
969619754 4:8273128-8273150 GACCCAGGCCAGGCCCAGCCGGG - Intronic
976076523 4:81305283-81305305 AACACAGGAGAGTCCCTGAGTGG - Intergenic
982213947 4:153064532-153064554 GACTGAGGAGAGTTGCTGCCCGG + Intergenic
985650218 5:1104092-1104114 GACCCAGGAGGGGCCTGGCCTGG + Intronic
985884753 5:2668854-2668876 GACCCTGCAGAGACCCTGACTGG + Intergenic
986007154 5:3677749-3677771 GCCCCAGCAGACTCCCAGCCTGG + Intergenic
986395120 5:7321636-7321658 GGCTCAGGAGACTCCCTGGCTGG + Intergenic
986949140 5:13060516-13060538 GCCCCAGTAGAGTCCCCACCGGG - Intergenic
991307384 5:65192783-65192805 GACCCAGAGGAGTCCTTGCTGGG - Intronic
992509162 5:77416411-77416433 GACCCAGGACAGCCCCAACCTGG - Intronic
997201605 5:132013117-132013139 ATCCCAGCAAAGTCCCTGCCAGG - Intergenic
999382040 5:151128112-151128134 GAGCCAGGAGAGTCCCCGCCTGG + Intronic
1000275741 5:159733317-159733339 GTCCCAGGAAAGTCCCTGGATGG + Intergenic
1001055304 5:168444606-168444628 GCCCCAGGAGCTGCCCTGCCTGG + Intronic
1001528219 5:172444180-172444202 GATCCAGGAGAGACTCTGACTGG - Intronic
1001559371 5:172659299-172659321 GCCCCAGGAGAGCACCTGCGGGG - Intronic
1001680153 5:173550804-173550826 GAGCCAGGAGTTTCCCTACCTGG + Intergenic
1003518147 6:6834787-6834809 GACCAATGAGAGTCCCTTCTCGG - Intergenic
1003970112 6:11291085-11291107 TGTCCAGGAGAGTCCCTGACTGG + Intronic
1006114754 6:31769674-31769696 GACTCAGGAGCGGCGCTGCCGGG - Exonic
1008232211 6:48996680-48996702 GCAGCAGGAGAGTCCCTGCAAGG + Intergenic
1014234033 6:118935209-118935231 GAGCCAGGAGGGTCCCGGGCGGG + Intergenic
1015804038 6:137090514-137090536 GCCCCATGATAATCCCTGCCTGG - Intergenic
1016874002 6:148846947-148846969 CACTCAGGAGAGCCCATGCCTGG - Intronic
1016997510 6:149970736-149970758 GACCCATGGGAGTCCTTGCCAGG + Intronic
1017001289 6:149999440-149999462 GACCCATGGGAGTCCTTGCTGGG - Intergenic
1017786875 6:157763570-157763592 GACCAGGGAGTGTCCCTTCCAGG + Intronic
1018304606 6:162442278-162442300 GACCCAGGAGCCCCCCTGCGCGG + Intronic
1018895294 6:168012633-168012655 GACCTGGGAGTGTGCCTGCCAGG + Intronic
1018947266 6:168356614-168356636 GACCCAGGACGGTACCTGGCAGG + Intergenic
1019550879 7:1601984-1602006 GACCCAGGAGGGTCCCGTCGGGG + Intergenic
1019603836 7:1898716-1898738 GAGCCAGCACAGTCACTGCCAGG + Intronic
1022565034 7:31391117-31391139 GACCCTGCAGAGACCCTGCAGGG + Intergenic
1023856279 7:44186068-44186090 GGCCCAGGACAATTCCTGCCAGG + Intronic
1025281614 7:57629761-57629783 GACCCAGCAGAGCCCGAGCCCGG - Intergenic
1025303116 7:57835754-57835776 GACCCAGCAGAGCCCGAGCCCGG + Intergenic
1026135599 7:67658067-67658089 GCCGCAGCAGAATCCCTGCCTGG + Intergenic
1027200475 7:76061000-76061022 CACCCTGGAGAGTCCAGGCCTGG + Intronic
1029174670 7:98656101-98656123 AACCCAGGAGTGTCCAGGCCTGG - Intergenic
1029179553 7:98690183-98690205 GACCCGGGAGGATCCCTGGCTGG + Intergenic
1032020548 7:128405338-128405360 GCCCCAGGAGAGGCCCAGCCAGG - Intronic
1032548029 7:132759660-132759682 GCACCAGGACACTCCCTGCCGGG - Intergenic
1034902615 7:154916638-154916660 GCCCCAGGAGAGTCCCGGCTCGG + Intergenic
1035084010 7:156240707-156240729 GCCCCAGGTGGCTCCCTGCCAGG - Intergenic
1035482553 7:159198880-159198902 GACCCAGGCGAGGCTCTGCCTGG - Intergenic
1036736507 8:11322770-11322792 GATGCAGGAGAGTCCCTGAAAGG + Exonic
1038478735 8:27886933-27886955 CCCCCAGGAGGGTCCCTGCAGGG + Intronic
1038612016 8:29066893-29066915 AGCCAAGGAGAGTCCCTACCAGG + Intergenic
1039086700 8:33787366-33787388 GACCCAGGGGAGTTCCTGGCTGG + Intergenic
1039502912 8:38031073-38031095 GATCCAGGAGAGGCCTGGCCTGG + Intronic
1039615782 8:38953964-38953986 GACCTAGGAGATCCCTTGCCAGG - Intronic
1041696508 8:60742146-60742168 GCCCCAGCAGAGTCCCAGCATGG + Exonic
1042962965 8:74321790-74321812 GACGCACGAGAATCCCTGCCTGG + Intronic
1047212200 8:122849084-122849106 AACCCAGAAAGGTCCCTGCCTGG - Intronic
1049161945 8:141103436-141103458 GACACAGGTGAGGTCCTGCCAGG - Intergenic
1049214890 8:141402969-141402991 GTCTCAGGAGGGTCCCTGGCTGG + Intronic
1049250831 8:141588189-141588211 GCCCCAGGAGGGTGCCAGCCTGG + Intergenic
1049259057 8:141629173-141629195 CACCCAGCAGACTGCCTGCCAGG - Intergenic
1049605216 8:143526157-143526179 AACCCTGGAGAGACCCTGGCTGG + Intronic
1049813928 8:144589350-144589372 GCCCCAGGGTAGGCCCTGCCGGG - Intronic
1049828760 8:144686632-144686654 GAGGCGGGAGAGTCCCTGCAAGG - Intergenic
1049988022 9:970336-970358 GACCCAGGAGAGTGCAAGACAGG + Intergenic
1050343221 9:4662008-4662030 TGCCCAGGAGTGTTCCTGCCTGG - Exonic
1052274826 9:26664396-26664418 AACCGAGGAGCGTCTCTGCCCGG + Intergenic
1060823518 9:126674572-126674594 GAGCCAGGTGACTGCCTGCCTGG + Intronic
1060995252 9:127872166-127872188 GACCCAGGACAGCACCTGGCTGG - Intronic
1061482242 9:130902991-130903013 GACCCAGGCCAGGCCCGGCCCGG - Exonic
1062357388 9:136171256-136171278 CACCCAGGGGAGGCCCTCCCTGG + Intergenic
1062366942 9:136214691-136214713 GACCCAGATGAGGCCATGCCCGG + Intronic
1062413228 9:136434980-136435002 GGGCCAGGAGAGTCCTTGCTTGG - Intronic
1185603780 X:1355509-1355531 GGCCCAGGGGAGACCCAGCCAGG + Intronic
1186099017 X:6135182-6135204 GACCCAGGAGTGTCCCAGGAGGG + Intronic
1186881713 X:13873045-13873067 AACAGAGGGGAGTCCCTGCCTGG + Intronic
1188242424 X:27808640-27808662 TACCCAAGAGGATCCCTGCCCGG - Intronic
1189286959 X:39858492-39858514 GACCCACGAGAGACACTGGCAGG - Intergenic
1191009832 X:55748456-55748478 AAGCGAGGAGAGTCTCTGCCTGG + Intronic
1200116784 X:153773010-153773032 GTCCCATGTGAGTCCCGGCCTGG + Exonic
1200152456 X:153957941-153957963 GCTCCAGGAGAGTCTCAGCCAGG - Intronic