ID: 953268501

View in Genome Browser
Species Human (GRCh38)
Location 3:41416673-41416695
Sequence TAGGAAACACAGCCTGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953268500_953268501 -8 Left 953268500 3:41416658-41416680 CCACAATAAAATTATTAGGAAAC 0: 1
1: 0
2: 6
3: 68
4: 556
Right 953268501 3:41416673-41416695 TAGGAAACACAGCCTGAGTAAGG 0: 1
1: 0
2: 1
3: 11
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953268501 Original CRISPR TAGGAAACACAGCCTGAGTA AGG Intronic
902548177 1:17203477-17203499 CAGGAACCCCAGCCTGATTAGGG - Intergenic
903527558 1:24003671-24003693 AATCAAACAGAGCCTGAGTAGGG + Intergenic
904296688 1:29524004-29524026 TAGGAAACCTAGGCTGAGTTGGG + Intergenic
904302414 1:29562850-29562872 GAGGAAACCCAGCATGAGCAGGG + Intergenic
904893154 1:33794394-33794416 AAGGAAACTCAGGCTGAGTTTGG + Intronic
906822544 1:48944648-48944670 CAGAAAACACAGGCTGAGGAAGG - Intronic
907718989 1:56954022-56954044 TATGAGACACAGCCTGGGGAGGG - Intronic
908571465 1:65415769-65415791 AATGAAACACAGTCTGTGTAGGG + Intronic
908676177 1:66606625-66606647 AAGGAATCAGAGCCTGAGTCAGG - Intronic
909331006 1:74410828-74410850 GAGGAATCACAGCCTGAGACTGG + Intronic
910110770 1:83680663-83680685 AAGGGATCACAGCCTGAGCAAGG + Intergenic
912083832 1:105975227-105975249 TAGGAATAACATCCTTAGTAAGG + Intergenic
913548764 1:119896345-119896367 TAGCAAACTGAGGCTGAGTAGGG - Exonic
915002659 1:152607709-152607731 TAGGAAACTAAGCCTGAGCCAGG - Intergenic
916085699 1:161267567-161267589 GAGGAAACACAGCCCAAGAAGGG + Intronic
916374812 1:164141332-164141354 TAGGAAACAGAGACAGAGGAAGG + Intergenic
917065860 1:171092519-171092541 TAATAAACACTGGCTGAGTATGG - Intronic
919698210 1:200601663-200601685 TAGAAAACAGAGTGTGAGTAAGG - Intronic
919842486 1:201619378-201619400 TGGGCAACACAACCTGAGTTGGG + Intergenic
919844543 1:201633367-201633389 TAGGAAACTCAGGCTCAGAAGGG + Intronic
920369298 1:205467804-205467826 TTGGAATCCCAGCCTGAGCACGG - Intergenic
922881368 1:228983532-228983554 AAGGAAACACAGCCTGGGGTTGG - Intergenic
1067204186 10:44199548-44199570 TAGGAAACATAGCCAGTGTCGGG + Intergenic
1067723463 10:48748328-48748350 AAGGAAACAAAGGCTGAGAAAGG + Intronic
1067879937 10:50034564-50034586 TAGGAAACTGAGGCTGAGAAAGG + Intergenic
1067891947 10:50144816-50144838 TAGGAAACTGAGGCTGAGAAAGG - Intergenic
1068580612 10:58735263-58735285 GAAGAAAAACAGCCCGAGTATGG - Intronic
1071886704 10:89959224-89959246 TAAGACACACAGCCTTAATATGG - Intergenic
1072889015 10:99304975-99304997 TAGGAAACAAAGACTGGTTAGGG + Intergenic
1072973890 10:100040947-100040969 TACGTAACACAGGCTGAGCACGG - Intergenic
1073254842 10:102144295-102144317 TAGGAAACTCAGGGTAAGTATGG + Exonic
1073554337 10:104434095-104434117 GAGGAAACAGAGGCTGAGTGAGG - Intronic
1074517524 10:114184407-114184429 TAATAAGCACAGCCTGAGGATGG - Intronic
1075576787 10:123583649-123583671 TAGAAAGCACAGCCTGTGTCGGG + Intergenic
1075933807 10:126322697-126322719 AAGGAAACAAAGCCTGAGCAAGG + Intronic
1076644183 10:131940906-131940928 TAGGAAACACAGCAATACTAAGG + Intronic
1077048977 11:558279-558301 TAGGAACCCCTGCCTGAGCAGGG - Intronic
1077395934 11:2321240-2321262 GAGGAAACACAGCCTGCATTTGG - Intergenic
1078919442 11:15815664-15815686 CAGCAAACACAGGCTTAGTATGG - Intergenic
1080552725 11:33387656-33387678 TAGGGAAAACAGCCTGGGTGAGG + Intergenic
1080665631 11:34333463-34333485 AAGGAAAAACAGGCTGGGTATGG + Intronic
1081960067 11:47129493-47129515 TATGAAACACAGGCTGCATATGG - Intronic
1083101978 11:60317691-60317713 TAGAAAACAGAGCCTGAGACAGG - Intergenic
1083949323 11:65945401-65945423 GGGGAAACACAGGCAGAGTAGGG + Intergenic
1084052254 11:66607489-66607511 GGGGAAAGACAGCCTGAGTCTGG - Intergenic
1084121292 11:67070561-67070583 TAGGAAACCCAGCCCGAGGTGGG + Intronic
1084217497 11:67657607-67657629 TAGGAAACACAGATTGCTTAGGG + Intergenic
1084345148 11:68542090-68542112 GAGGAAACACAGCCAGTGTGAGG + Intronic
1084443254 11:69188158-69188180 TAGGCAAGACAGCATGTGTAGGG + Intergenic
1085108022 11:73862618-73862640 TAAGAAAGTCAGCCTGAGTTGGG + Intronic
1085439877 11:76550239-76550261 TAGGGTCCACAGCCTAAGTACGG - Exonic
1085945814 11:81271341-81271363 GCGGAAACACAGCATGTGTATGG + Intergenic
1087799952 11:102492943-102492965 CAGGAAACCCAGGCTGAATAGGG + Intronic
1087996818 11:104819245-104819267 GATGAAATACAGCCTGAGCAGGG + Intergenic
1089125770 11:116175499-116175521 AAGGAAACTCAGTTTGAGTATGG + Intergenic
1089278320 11:117354929-117354951 TAGGAAACGCAGCCTGAGGAGGG + Intronic
1089994039 11:122887798-122887820 TAGCAAAAATAGACTGAGTAGGG + Intronic
1090423636 11:126592477-126592499 TAGGAGAAAGAGCCTGAGTTTGG - Intronic
1091607949 12:1972964-1972986 TGGGAAACACAGGCTGCGTTTGG + Intronic
1091673507 12:2469708-2469730 TAGTAAAAACAGCCTGAAGAAGG - Intronic
1092037129 12:5345977-5345999 TTAGGAACACAGCCCGAGTATGG + Intergenic
1093105968 12:15087518-15087540 TGGGAATCACAGCCTCAATAGGG + Intergenic
1093800177 12:23363226-23363248 TAGGATACAGGGCCTGAGCAGGG + Intergenic
1097674782 12:62588135-62588157 AAGAAAACTCAGCCTGAGAATGG + Exonic
1100548980 12:95628976-95628998 TAGGTGACACAGCCTCAGGAGGG + Intergenic
1105801717 13:23909825-23909847 CAGGAAAGACAGCATGAATAGGG - Intergenic
1106908638 13:34438667-34438689 TAGGAAACACACACTGTGGAAGG - Intergenic
1109389841 13:61678937-61678959 AAGGAAACTCAGCCTCAGAAGGG - Intergenic
1111022824 13:82477270-82477292 TGGGAAACATAGCCTCAGTTTGG + Intergenic
1112100206 13:96180123-96180145 CAGGAAACACAGGCTGGGTGCGG - Intronic
1113056702 13:106275820-106275842 AAGGACACACAGCCTCAGTCAGG + Intergenic
1113930275 13:113964664-113964686 TAGGAGACACGGCCTGGTTATGG + Intergenic
1116639864 14:47447460-47447482 CAGAAAACACAGCATTAGTATGG - Intronic
1117485891 14:56196330-56196352 TAGTAAACACAGACTTAGAAGGG - Intronic
1118475725 14:66115133-66115155 AAGGAAAGGCAGCCTGGGTAAGG - Intergenic
1121933768 14:97997534-97997556 GAGGAAACACAGCAGGAGAAAGG - Intergenic
1124848336 15:33312016-33312038 GAGGAAACTGAGGCTGAGTAGGG - Intronic
1125913200 15:43460547-43460569 TAGGAAAAAAAGCCTGAGCGTGG - Intronic
1127615936 15:60685553-60685575 TCCGGAACACAGCCCGAGTAGGG + Intronic
1128443084 15:67731627-67731649 TAGAATGCACAGCCTGAGTCAGG - Intronic
1130605395 15:85312073-85312095 TAAGAAAAAAAGCCTGATTAAGG - Intergenic
1135487529 16:22879206-22879228 CAGAAAACAGAGCCTGAGTTTGG - Intronic
1135582868 16:23642775-23642797 TAGGAAACTATGGCTGAGTATGG - Intronic
1135750268 16:25052963-25052985 TAGGAAACACAGGCTAGGCATGG - Intergenic
1135968636 16:27055937-27055959 GAGGAAACCCAGACTGAGAAAGG + Intergenic
1136670825 16:31855337-31855359 TAGCAAACACAGCCTAAGCAAGG + Intergenic
1137766898 16:50984893-50984915 TAGGAAACAGGACCTGCGTAAGG + Intergenic
1139646980 16:68338568-68338590 GAGGAAGCACAGCCTGGGGAAGG + Intronic
1141773257 16:86104430-86104452 GAGGAAACAGAGCCTGAGAGCGG + Intergenic
1146456861 17:33015363-33015385 TAGGAAAGAGAGGCAGAGTAGGG + Intronic
1147561333 17:41511218-41511240 TAAGAAGCCCAGCCTGAGCAGGG + Intergenic
1148237398 17:45978062-45978084 AAGGACACACAGGCTGAGTGAGG - Intronic
1148458624 17:47824683-47824705 TAGGAAACACTGACTTAATAGGG - Intronic
1148813538 17:50310531-50310553 TAGGAAACAATACCTGAGTAAGG - Intergenic
1148832824 17:50445990-50446012 CAGAAAACACAGCCTCAGGAAGG + Intronic
1149076553 17:52602202-52602224 GAGGAAACTCAGCCTCAGAAGGG + Intergenic
1153452554 18:5245742-5245764 AAGGAAACACAGCCGTACTAAGG + Intergenic
1157280987 18:46346182-46346204 TAGGAACCAGAGCCTGAGAGGGG + Intronic
1157325128 18:46663415-46663437 TAGGAATTCCAGCCTGAGTAAGG - Intergenic
1157804138 18:50645601-50645623 AAGGAAACAGAGCCGGAGAAGGG + Intronic
1158485711 18:57864151-57864173 GAGGAAAGCCAGTCTGAGTAAGG + Intergenic
1160218257 18:76953151-76953173 TAGTAAAGACAGGCTGAGTAAGG - Intronic
1162039538 19:7961655-7961677 TATGAGACACAGCCTGGGTACGG + Exonic
1167574147 19:50309722-50309744 GAGGAAGCACAGCCTGGGTCTGG + Exonic
1168094861 19:54108591-54108613 CAGGAAACTCAGCCTCAGAATGG - Intronic
1168124472 19:54275970-54275992 AAGGACACACAGCCTGAAGATGG - Exonic
1168177514 19:54635568-54635590 AAGCACACACAGCCTGAGGATGG + Exonic
1168181794 19:54666708-54666730 AAGAACACACAGCCTGAGGACGG + Exonic
925543184 2:4988728-4988750 TAGCAAAGAAAGCATGAGTAGGG + Intergenic
926131777 2:10307563-10307585 TAGGAGACACAGCTTCAGTGAGG - Intronic
926206190 2:10835633-10835655 GAGGAAACCCAGCCTGGGTTTGG + Intronic
926907487 2:17819541-17819563 TAGGAAACAGAGGCTGGGAAGGG - Intergenic
928198171 2:29229612-29229634 GAGGAAACACAGGCTCAGAATGG - Intronic
928537618 2:32255539-32255561 TAAGAAATACAGCCTCAGAAAGG + Intronic
930050104 2:47208685-47208707 TAAGAATCTCAGCCTGAGTTTGG + Intergenic
931920647 2:67011791-67011813 TAGGAAGCAGAGCCTGAGGCAGG + Intergenic
935566887 2:104618703-104618725 TAGGAAACTCAGGCTGGGCACGG + Intergenic
941272296 2:163445476-163445498 TAGGAAATACAGTCTGAGAACGG - Intergenic
941964568 2:171288160-171288182 CAGTAAACACAGCCTGACAAGGG - Intergenic
942176928 2:173343349-173343371 TAGGATACTCAGGCTGAGTTAGG - Intergenic
942883692 2:180895885-180895907 TAGTAACCAGAGCCTGAGAAGGG - Intergenic
942934999 2:181544386-181544408 TCTGAAGAACAGCCTGAGTATGG + Intronic
943330038 2:186548168-186548190 TAGGAAACTCAGGCTAAGAAAGG + Intergenic
944362901 2:198879546-198879568 TGGGAAACACAGCTAGAGAATGG - Intergenic
945204055 2:207312991-207313013 TAGAAAACAGAGCCTGAGGCAGG + Intergenic
946850176 2:223898207-223898229 TGGGAAACATACCCTGTGTAGGG - Intronic
947788494 2:232846784-232846806 TAGGAAACAGAGGCTCAGAATGG + Intronic
1170902572 20:20480297-20480319 TAAGAAATACAGTATGAGTAAGG + Intronic
1172444800 20:34987421-34987443 TAGCAAACAAAGCCTCAGGAGGG - Intronic
1176902645 21:14461889-14461911 TAGCAAATACAGCCAGAGCAAGG - Intergenic
1178687510 21:34723115-34723137 CAGAAAACACAGCCTGGGTGTGG - Intergenic
1179360791 21:40706298-40706320 TAGCAAAGGCAGCCTGGGTAAGG + Intronic
1180678257 22:17603901-17603923 AGGGATAGACAGCCTGAGTATGG + Intronic
1182777194 22:32839837-32839859 AAGGAAACACAGGCTTAGGAAGG - Intronic
1183225296 22:36545806-36545828 AAGGTCACACAGCTTGAGTATGG + Intergenic
1184236177 22:43184341-43184363 CAGGAAGCTCAGGCTGAGTAAGG + Intronic
1185116348 22:48940421-48940443 CAGGAAGCACAGCCTGAGGCAGG + Intergenic
1203245506 22_KI270733v1_random:65219-65241 TAGGAAAAACAACCTGCCTAGGG - Intergenic
949864512 3:8536425-8536447 AAGGAAACACATCCTGGGGAGGG - Intronic
950591334 3:13937567-13937589 TGGGAAACAGAGCCTGAGGCTGG - Intronic
950712402 3:14821684-14821706 TAAGAAACAGAGCCTGAGGCTGG - Intronic
951443438 3:22748737-22748759 GAGGAAACACAGCCTCATTTGGG + Intergenic
952211119 3:31230494-31230516 CAGGAAACAAAGCCAAAGTATGG + Intergenic
952772398 3:37014158-37014180 TTGAAAACACTGACTGAGTAGGG + Intronic
953268501 3:41416673-41416695 TAGGAAACACAGCCTGAGTAAGG + Intronic
959611944 3:108305179-108305201 TAGAAAACAGAACCTGAGCAAGG + Intronic
960102055 3:113754231-113754253 TAGGAAAAACAGGCTGGGCATGG + Intronic
960291968 3:115896932-115896954 TTGGAAACACATTCTGAGCAAGG + Intronic
961883722 3:130081754-130081776 GAGGAAACACAGGGTGTGTAGGG + Intergenic
962398070 3:135034889-135034911 TAGGATGCACAGCCAGAGGAAGG + Intronic
964637134 3:158870373-158870395 TAAGAATAACAGCCTGAGGATGG - Intergenic
965721518 3:171667517-171667539 TAGGAAACACAGTATTAGTTGGG + Intronic
968578579 4:1379241-1379263 TAGGACACACAGCCACAGTTGGG - Intronic
970360139 4:15301034-15301056 TAGGACACACAGTATGAGGAAGG + Intergenic
970787560 4:19817414-19817436 GAGAAAACAAAGCCTGAGTTTGG + Intergenic
977708753 4:100100420-100100442 TAGGAAGCACAACCTGAAAATGG + Intergenic
979136424 4:117117152-117117174 TTGGAACCACAGCCTCATTAAGG + Intergenic
980065192 4:128180240-128180262 TAAGAAACACAGGCTGGGTGAGG - Intronic
982408668 4:155047812-155047834 TAGGAGCCACAGTCTGAGAATGG + Intergenic
983333204 4:166358385-166358407 TAGGAAACAAAGCATGGGAAAGG - Intergenic
987492759 5:18601448-18601470 TAGCAAAAATAGCCTGAGAAAGG + Intergenic
987829264 5:23074842-23074864 TAGGAAACACAGTTTGAGAAAGG - Intergenic
991006683 5:61834724-61834746 TACGAAACATAGCCTGATTTTGG + Intergenic
993495638 5:88605601-88605623 TAGGAAACCCAGCCTAAGGCAGG + Intergenic
995240529 5:109881200-109881222 TAGGAGCCACAGGCTGAGTCTGG - Intergenic
996390895 5:122960018-122960040 TGGAAAACACAGCCCGTGTAGGG - Intronic
997719335 5:136065349-136065371 TAGGATACCCAGCATGAGCAAGG - Intergenic
998129689 5:139645332-139645354 TAGGGAAGCCAGGCTGAGTAGGG + Intergenic
999417709 5:151414298-151414320 TAGGAAAAACAGCATAAATAAGG + Intergenic
1000287141 5:159836584-159836606 TAGGAAACAAGGCCAGAGGAAGG + Intergenic
1001840851 5:174875567-174875589 GAGGAAACACAGCGTGAGGCAGG - Intergenic
1002972160 6:2034929-2034951 GAAGAAACCCAGCCTGAGGATGG + Intronic
1002978358 6:2109458-2109480 AAGGAAACACAGCCTAAGGCAGG + Intronic
1005569678 6:27132781-27132803 AAGGAAAAACAGCGTGAGCAGGG + Intergenic
1007550100 6:42722529-42722551 TCGGAATCACAGCTTGAGCAGGG + Exonic
1011622130 6:89252839-89252861 TAGCAGACCCAGCCTGAATAAGG - Intergenic
1012866861 6:104628338-104628360 AAAGATACACAGCCTGACTAAGG + Intergenic
1014059095 6:117050287-117050309 TAGCAACCTCAGCCTGAGTATGG - Intergenic
1016011642 6:139143178-139143200 TAGAAAACAGAGGCTGAGAAAGG - Intronic
1019871192 7:3764019-3764041 TAGAAAATACAGCCTTGGTATGG + Intronic
1023838073 7:44080018-44080040 GGAGAAACAAAGCCTGAGTACGG - Intronic
1027616144 7:80427003-80427025 TAGGAACATGAGCCTGAGTAAGG + Intronic
1027722556 7:81762524-81762546 ATGGAAACATAGCTTGAGTAAGG - Intronic
1029121891 7:98273855-98273877 TAGGAACCAGAGCTTGAGTCTGG + Intronic
1029157693 7:98528891-98528913 CAGGAAGCAAAGCCTGAGTTGGG - Intergenic
1030160853 7:106507148-106507170 CAGGAAGCAGAGGCTGAGTATGG + Intergenic
1030626636 7:111852252-111852274 TAGGAGACTCCGGCTGAGTATGG - Intronic
1031023674 7:116656277-116656299 TAGGAAAAACAACCTGAGGATGG - Intergenic
1036038454 8:5046670-5046692 AAGGAAACACAGCTTCAGCAAGG - Intergenic
1037351029 8:17956014-17956036 GAGGAAATACAGGCTTAGTAAGG - Intronic
1037386569 8:18349186-18349208 TAGCAAACACAGCCTTAAGAGGG + Intergenic
1038119624 8:24598318-24598340 TAGAAAACCCAGCTTGAATAAGG + Intergenic
1040499525 8:47994819-47994841 TAGGCAACACAGTCGGAGGATGG - Intergenic
1040897499 8:52384054-52384076 TATGAAGCATATCCTGAGTATGG - Intronic
1041306698 8:56469226-56469248 TAGTAAAGAGAGCCTGGGTAAGG - Intergenic
1042296717 8:67226842-67226864 TAGGAAACTCAGCCCCAGAAAGG - Intronic
1044236102 8:89831763-89831785 GAGAAAACAGAGCCTTAGTAAGG - Intergenic
1045751394 8:105488448-105488470 TAGGAAACACAGGGTTAGAAAGG + Intronic
1046029380 8:108765365-108765387 TAGGCAACACAACCTAACTAAGG + Intronic
1047995909 8:130335688-130335710 TGGGAGACACAGCCTCAGCAGGG - Intronic
1049271128 8:141696863-141696885 TAGGAGGCACAGCCTGTGCAGGG + Intergenic
1049388245 8:142354986-142355008 ACAGAAACACAGCCTGAGGAAGG + Intronic
1050154343 9:2649960-2649982 AAGGAAACTCAGCCTTAGGAAGG - Intronic
1050311462 9:4357339-4357361 ATAGAACCACAGCCTGAGTAAGG + Intergenic
1050585849 9:7110595-7110617 TTGGATCCACAGCCTGATTATGG + Intergenic
1051900114 9:22028917-22028939 TATGAAACACAGATTGATTATGG + Intronic
1052732138 9:32300445-32300467 TAGGCAACAAAGACTGAGTTGGG - Intergenic
1052755271 9:32534590-32534612 TATGTGACACAGCCTGTGTATGG + Intergenic
1056094831 9:83242341-83242363 TAGGAAACTCAGGCTGATTGAGG + Intergenic
1056567940 9:87791405-87791427 CAGGAAACACAGGCTGATTCTGG - Intergenic
1059745465 9:117196146-117196168 AAGGTAACACAGCTGGAGTATGG - Intronic
1060676593 9:125520829-125520851 TAGGAAACCCAGTCAGAGTTGGG - Intronic
1203461845 Un_GL000220v1:48291-48313 TAGGAAAAACAACCTGCCTAGGG - Intergenic
1187991723 X:24881521-24881543 TATGAAAAACTGCATGAGTAGGG - Intronic
1188097139 X:26037426-26037448 TAGGAAAAACAGATTGATTATGG - Intergenic
1188610193 X:32086378-32086400 TATGAACCACATCCAGAGTAAGG + Intronic
1189257180 X:39649662-39649684 TAGGAAACACAGGCTGGGTCAGG - Intergenic
1190151536 X:47954096-47954118 GAGGAGACACAGGCTGAGGATGG + Intronic
1190161196 X:48032628-48032650 GAGGAGACACAGGCTGAGGATGG - Intronic
1190335434 X:49258886-49258908 GAGCAAACACAGCCTGTGCAGGG - Intronic
1192850563 X:74951693-74951715 TAGGAAAGAGAGCCTGACAATGG + Intergenic
1195196222 X:102500048-102500070 CAGGCAAGACAGCCTGTGTAGGG - Intergenic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1199564864 X:149205302-149205324 CAGGAAACAAAGACAGAGTAGGG + Intergenic