ID: 953270583

View in Genome Browser
Species Human (GRCh38)
Location 3:41439084-41439106
Sequence TGGGGTTCCCCGTGAACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 58}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953270579_953270583 -1 Left 953270579 3:41439062-41439084 CCAGAGAGTGTGAAATGGGGGTT 0: 1
1: 0
2: 1
3: 12
4: 142
Right 953270583 3:41439084-41439106 TGGGGTTCCCCGTGAACAAAAGG 0: 1
1: 0
2: 0
3: 3
4: 58
953270575_953270583 3 Left 953270575 3:41439058-41439080 CCAGCCAGAGAGTGTGAAATGGG 0: 1
1: 0
2: 2
3: 11
4: 135
Right 953270583 3:41439084-41439106 TGGGGTTCCCCGTGAACAAAAGG 0: 1
1: 0
2: 0
3: 3
4: 58
953270573_953270583 24 Left 953270573 3:41439037-41439059 CCAGGTGTGGCAAGACAAAAGCC 0: 1
1: 0
2: 1
3: 16
4: 105
Right 953270583 3:41439084-41439106 TGGGGTTCCCCGTGAACAAAAGG 0: 1
1: 0
2: 0
3: 3
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953270583 Original CRISPR TGGGGTTCCCCGTGAACAAA AGG Intronic
900290136 1:1920257-1920279 TGGGGTCCCCCTGGAAGAAATGG - Intergenic
900472241 1:2860685-2860707 TGGGGCTCACCAGGAACAAATGG - Intergenic
903530261 1:24024730-24024752 TGGGGTTCCCCAGAAGCAAATGG + Intergenic
906567405 1:46810983-46811005 TGGGGCTTCCTGAGAACAAAGGG + Intronic
911222578 1:95264687-95264709 TGAGGTTCCCCATGATCCAAAGG + Intergenic
915064921 1:153217079-153217101 TGTGGTTCCAAGCGAACAAAGGG - Intergenic
919759116 1:201085862-201085884 TGGGGTTCCCCTTGCACATTAGG + Intronic
921973336 1:221174982-221175004 TGGGGTGCCCTGTGAGCAAACGG - Intergenic
922440911 1:225653861-225653883 TGGGATTCCTCGGGAAGAAAAGG - Intergenic
1063090653 10:2863581-2863603 TGGGGTTCCCCATGGAGAGATGG - Intergenic
1064145991 10:12826813-12826835 TGGGGTTCCCTTTGACCAGAGGG - Intronic
1070285081 10:75077077-75077099 AGGGCTTCCCGGTGAAGAAAGGG + Intergenic
1071232728 10:83607505-83607527 AGGGGTTCACCTTGAACAAAAGG - Intergenic
1072306996 10:94117210-94117232 TGAGCTTCCCAGTGAATAAAAGG + Intronic
1075212867 10:120506123-120506145 TGGGGTTCTCAGAGAACAGAAGG + Intronic
1086267765 11:85021584-85021606 TGAGATTCCCAGTGAACACACGG + Intronic
1094088643 12:26622886-26622908 TGAGGTTCCACTGGAACAAAAGG + Intronic
1095684076 12:45012459-45012481 TAGGGTACACCTTGAACAAAGGG + Intergenic
1105321758 13:19330820-19330842 TGGGTTTCACCGTGTAAAAAAGG + Intergenic
1116941881 14:50798667-50798689 TTGAGTTCCCCTTGAACAATGGG - Intronic
1124393418 15:29279886-29279908 TTGGGTTGCCCATGTACAAAAGG - Intronic
1132520250 16:383964-383986 TGGGATTCCCGGGAAACAAAGGG - Intronic
1133308712 16:4828615-4828637 TGGGGTTCTCACTGTACAAACGG + Intronic
1138922968 16:61555697-61555719 TGGGGTACCCCGTGAATCAGAGG - Intergenic
1141289012 16:82700286-82700308 TGGGATGCCCTGTGAACAAAAGG - Intronic
1145018970 17:19415499-19415521 TGGGTTTTCCCGTGGACAGATGG + Exonic
1147049168 17:37778200-37778222 TGGGGTTCCCCCTGCCCATAAGG + Intergenic
1160829398 19:1096011-1096033 TGGGGTTCTCCGTGAACCTGGGG - Intergenic
930862261 2:56087270-56087292 AGGGGTTCCTGGTGAAGAAAAGG + Intergenic
930899333 2:56484558-56484580 TGGGGTCCCCCGGGAAAAACTGG - Intergenic
931553329 2:63471184-63471206 TGGGGATAGCAGTGAACAAAAGG - Intronic
937045856 2:118851179-118851201 AGGGGCTCCCAGTGAGCAAAAGG + Intergenic
943720063 2:191194647-191194669 TGGGGTTCCTTGGGAAGAAAAGG - Intergenic
948630665 2:239300694-239300716 TGGGGTTCTCCGGGAAACAAAGG - Intronic
948636169 2:239339212-239339234 TGGGGTTGCCTGTAAACACAGGG + Intronic
1173916378 20:46711262-46711284 TGGGCTTCCCCATCTACAAATGG - Intronic
1176263620 20:64197069-64197091 GGAGGTTCCCCATGGACAAATGG - Intronic
1176944762 21:14966032-14966054 TGGGGTTCCCCAGGAGCAACTGG + Exonic
1179053166 21:37906661-37906683 TGGGGGTCTCTGTGGACAAAAGG - Intronic
1183163549 22:36130954-36130976 TGGGATTTCCTGTGAAGAAAAGG - Intergenic
1185100265 22:48836559-48836581 TGGGGTCCCCCATCAACACAGGG + Intronic
949463080 3:4315070-4315092 AATGGTTCCCTGTGAACAAATGG + Intronic
950631995 3:14288009-14288031 TCGGTTTCCTCGTCAACAAAGGG + Intergenic
950663861 3:14483077-14483099 TGGGTGTCCCCCTGAACCAATGG - Intronic
953270583 3:41439084-41439106 TGGGGTTCCCCGTGAACAAAAGG + Intronic
959526328 3:107381510-107381532 TTGAGTTCCCTGTGAGCAAAGGG + Intergenic
960053953 3:113263243-113263265 TGCGGTGCCCCGTGACCTAATGG + Intronic
967880296 3:194297059-194297081 AGTAGTTCCCCGGGAACAAAGGG + Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
994140411 5:96335007-96335029 TGGGGTCGGCCTTGAACAAAAGG - Intergenic
994664116 5:102687810-102687832 TGGGGTTACCCACAAACAAAGGG - Intergenic
995002482 5:107151328-107151350 CGGGGTTCCCCATGAATAAGCGG - Intergenic
1001156933 5:169280608-169280630 TGGGTTTCCTGGTGAGCAAAAGG + Intronic
1028202759 7:87981507-87981529 TGGGGTTGCCCATGAAGAATGGG + Intronic
1035642880 8:1197379-1197401 TTGGGTTCCCCGGAAAGAAAAGG - Intergenic
1038568606 8:28640358-28640380 TATGGTTCCCCCTTAACAAACGG + Intronic
1039582589 8:38679003-38679025 TGGGGGTCCCAGTGCAGAAAGGG - Intergenic
1040878702 8:52180237-52180259 TGGGGGTTCCAGTCAACAAAAGG - Exonic
1042155411 8:65840884-65840906 TGCGGTTCCCTCTGAACAATAGG - Intronic
1049110365 8:140638481-140638503 TGAGGTACCTCGTGAAAAAAGGG - Intergenic
1061947627 9:133917659-133917681 TTGGTTTCCCCGTCAATAAAGGG - Intronic
1192369278 X:70499929-70499951 TGTGGTGTCCCGAGAACAAATGG + Exonic