ID: 953272321

View in Genome Browser
Species Human (GRCh38)
Location 3:41457705-41457727
Sequence CCTTTGTGTGCATCTTGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 106}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953272312_953272321 13 Left 953272312 3:41457669-41457691 CCCTCATGTCAGCCTCCTAACTC 0: 1
1: 0
2: 3
3: 44
4: 434
Right 953272321 3:41457705-41457727 CCTTTGTGTGCATCTTGTACAGG 0: 1
1: 0
2: 0
3: 9
4: 106
953272310_953272321 27 Left 953272310 3:41457655-41457677 CCCAACATCAGACTCCCTCATGT 0: 1
1: 0
2: 0
3: 8
4: 148
Right 953272321 3:41457705-41457727 CCTTTGTGTGCATCTTGTACAGG 0: 1
1: 0
2: 0
3: 9
4: 106
953272315_953272321 1 Left 953272315 3:41457681-41457703 CCTCCTAACTCCTGGATTTGCCA 0: 1
1: 0
2: 1
3: 29
4: 159
Right 953272321 3:41457705-41457727 CCTTTGTGTGCATCTTGTACAGG 0: 1
1: 0
2: 0
3: 9
4: 106
953272311_953272321 26 Left 953272311 3:41457656-41457678 CCAACATCAGACTCCCTCATGTC 0: 1
1: 0
2: 1
3: 19
4: 221
Right 953272321 3:41457705-41457727 CCTTTGTGTGCATCTTGTACAGG 0: 1
1: 0
2: 0
3: 9
4: 106
953272316_953272321 -2 Left 953272316 3:41457684-41457706 CCTAACTCCTGGATTTGCCACCC 0: 1
1: 0
2: 0
3: 13
4: 147
Right 953272321 3:41457705-41457727 CCTTTGTGTGCATCTTGTACAGG 0: 1
1: 0
2: 0
3: 9
4: 106
953272313_953272321 12 Left 953272313 3:41457670-41457692 CCTCATGTCAGCCTCCTAACTCC 0: 1
1: 0
2: 1
3: 14
4: 308
Right 953272321 3:41457705-41457727 CCTTTGTGTGCATCTTGTACAGG 0: 1
1: 0
2: 0
3: 9
4: 106
953272317_953272321 -9 Left 953272317 3:41457691-41457713 CCTGGATTTGCCACCCTTTGTGT 0: 1
1: 0
2: 0
3: 17
4: 151
Right 953272321 3:41457705-41457727 CCTTTGTGTGCATCTTGTACAGG 0: 1
1: 0
2: 0
3: 9
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953272321 Original CRISPR CCTTTGTGTGCATCTTGTAC AGG Intronic
902974004 1:20075611-20075633 CCATGGTGTGCAGCTTGTATTGG + Intronic
902995921 1:20224783-20224805 CTTTTGTTTGCAGCTTCTACAGG - Intergenic
905446459 1:38031019-38031041 GCTTTGTGTGCATCTTGGGAAGG + Intergenic
906574288 1:46874117-46874139 CCTTTTTGTGCCTTTTCTACTGG + Intergenic
906597684 1:47093787-47093809 CCTTTTTGTGCCTTTTCTACTGG - Intronic
906800423 1:48732414-48732436 ACTTTATGAGCATCTTGTTCAGG - Intronic
906847906 1:49214292-49214314 CATTTTTGTGCATCGTGTACTGG - Intronic
907240256 1:53077325-53077347 CCTTGAGGTGCAGCTTGTACAGG - Exonic
907717036 1:56935688-56935710 CTTTTGTTTCCTTCTTGTACAGG + Intronic
914968070 1:152278641-152278663 CCTTTGTTTGGATCTATTACTGG - Intergenic
921899114 1:220431764-220431786 GCTTTGTTTGCATCTGGTGCTGG + Intergenic
1062887069 10:1024744-1024766 CATTTGTGTGCATCTATTTCAGG - Exonic
1063522305 10:6751991-6752013 CCTTTCTGTTCCTCTTTTACTGG - Intergenic
1063621233 10:7651001-7651023 CCATTGTGTGCATCCTGTTCAGG - Intronic
1064438860 10:15334939-15334961 CCTTTATGTGTATCTTGAATCGG - Intronic
1066351456 10:34641062-34641084 CTTTTGTGTGTATATTGTTCTGG - Intronic
1067311455 10:45117653-45117675 CATTTGTGTCCATATTGTACAGG - Intergenic
1068674537 10:59756875-59756897 CCTTTCTGTGCACCTTCTACAGG - Intergenic
1069731560 10:70618989-70619011 CCTTCGCATGCATCTTGTTCTGG - Intergenic
1073952426 10:108825612-108825634 CCTGTGAATGCATCTTTTACAGG - Intergenic
1077655037 11:4010523-4010545 CCTTTGTGTGTGTCTTTTACTGG - Intronic
1084234369 11:67777253-67777275 CCCATGTTTGCATCTTGCACTGG + Intergenic
1088752794 11:112858908-112858930 CCTCTATGTGCCTCGTGTACAGG + Intergenic
1089840004 11:121408310-121408332 CATTTGCCTGCAACTTGTACTGG - Intergenic
1095499379 12:42819904-42819926 CCTTTGTCTGCATCTTGAGAAGG + Intergenic
1099302157 12:80910751-80910773 CCTTTTTGTGTATCTTCTGCTGG + Intronic
1106178752 13:27353043-27353065 GCTGTGTGTGCATCTGGGACCGG + Intergenic
1106496403 13:30281826-30281848 AGTTTGTGTGCATCTCGTGCAGG - Intronic
1106851040 13:33792428-33792450 TCCTTTTGTGCATCTTCTACAGG - Intergenic
1121220811 14:92284099-92284121 ACTCTGTGTGCATCTTTTGCTGG + Intergenic
1121633295 14:95437074-95437096 CCATTTTGGGCATCTTGTCCTGG - Intronic
1125094693 15:35837761-35837783 CCTTTCTGTTCTTCTTGAACTGG + Intergenic
1125343049 15:38693671-38693693 CTTTTGTGGGCCTCTTGTCCTGG + Intergenic
1127798275 15:62456448-62456470 CCTGGGTGTGCGTCTTGTGCAGG + Intronic
1128521163 15:68375720-68375742 CCTTTGTGTGCATTTTAAACAGG + Intronic
1131472165 15:92706914-92706936 CCTCTGTGCGCAACTTGCACGGG - Intronic
1133231794 16:4370513-4370535 CCTTTGGGTGCATTTAGTGCAGG - Intronic
1135699935 16:24623559-24623581 CCTGTGTTTTCATTTTGTACTGG - Intergenic
1147302159 17:39538431-39538453 CCTTTCTGGGCATTTTTTACTGG - Intronic
1148990734 17:51664897-51664919 CCTTGGTGTGCATCTACTGCAGG - Intronic
1152246843 17:79189091-79189113 CCTTTGTGTGCTTCTGTTCCTGG - Intronic
1153156894 18:2159909-2159931 CCTTTATGTGGAGCTTTTACTGG + Intergenic
1153792163 18:8588349-8588371 CATGTGTGTGCATTTTGTATGGG + Intergenic
1154361272 18:13663580-13663602 CCTTTTTGTGCATTTTACACAGG + Exonic
1157511629 18:48279510-48279532 CCTTTGTGTTCATTTTGTTTGGG - Intronic
1158303306 18:56076866-56076888 GCTTTGTGAGCATCTGATACTGG - Intergenic
1163503792 19:17691872-17691894 CCTTTGTATGAATCTTCTATTGG + Intergenic
1164892690 19:31838569-31838591 CCTTTGTGTGAAACTTCTTCTGG + Intergenic
926993837 2:18712000-18712022 CCTTTGTTTGCAGCTGGTCCGGG + Intergenic
928376465 2:30778665-30778687 CCTTAGTGTGCATCTCTTCCAGG - Intronic
930400480 2:50878521-50878543 CCCATGTGGGCATCCTGTACTGG + Intronic
930690729 2:54361201-54361223 TGTGTCTGTGCATCTTGTACTGG - Exonic
931931226 2:67136838-67136860 TCTTGGATTGCATCTTGTACTGG - Intergenic
936067864 2:109345554-109345576 TTTTTGTGTGCATCTTGTTGAGG + Intronic
938900608 2:135796131-135796153 CACTTGTGTGCAGCATGTACAGG + Intronic
940388344 2:153101196-153101218 GCTTTGTGTGAATCTTATATTGG + Intergenic
941654099 2:168124818-168124840 AATCTGTGTGCATCTTCTACAGG - Intronic
944023340 2:195133269-195133291 ACTTTGTGTGCATTGTGAACAGG + Intergenic
946940627 2:224766643-224766665 CCTTTCTCTGCATTTTGTATTGG + Intronic
947309398 2:228783958-228783980 CCTTTGTGTACATTTTTCACTGG + Intergenic
948088433 2:235269850-235269872 CCACTGGGTGCATCTTTTACAGG - Intergenic
1172226795 20:33310699-33310721 CCTCTGTGTGCCTCTTGGCCTGG - Intergenic
1173711792 20:45163959-45163981 CCTTTGTGTTTTTCTTGTTCTGG - Intergenic
1176182544 20:63757770-63757792 CCTTTGAGTGCACCTTTCACAGG + Intronic
1176411147 21:6450259-6450281 CCTTTGTGTGCAGGCTGTCCTGG - Intergenic
1178038793 21:28615668-28615690 CCCTTGTTTAAATCTTGTACTGG + Intergenic
1179686640 21:43058581-43058603 CCTTTGTGTGCAGGCTGTCCTGG - Intronic
950055828 3:10023654-10023676 CCTGTGGGTTCAGCTTGTACAGG + Intergenic
953272321 3:41457705-41457727 CCTTTGTGTGCATCTTGTACAGG + Intronic
953704361 3:45220040-45220062 CCCTTGTGTGCACCTTGTCATGG - Intergenic
954563836 3:51581577-51581599 CCTCTGTGCGCAGCTTGTATCGG + Intronic
956496334 3:69830490-69830512 CCTTTGGTTGCTTCTTGTTCTGG + Intronic
960323878 3:116270734-116270756 TCTGTGTTTGCAGCTTGTACAGG - Intronic
962802614 3:138903145-138903167 CCTTTCTGTGGGTCTTGTTCAGG + Intergenic
967197532 3:187041595-187041617 CAGTTCTGTGCATGTTGTACTGG + Intronic
979360255 4:119755110-119755132 CCTTTGTGTACAGCTTTCACTGG + Intergenic
992513482 5:77466003-77466025 CCTTTGAGTACATCTACTACTGG + Intronic
993694399 5:91043231-91043253 CATTTGTGTTCATCTTCTAAAGG + Intronic
994696890 5:103083306-103083328 CCTTTTTGTGTATCTACTACAGG + Intergenic
995897656 5:117033435-117033457 CCTTTGACTGCATATTGTTCAGG + Intergenic
998970243 5:147583411-147583433 CCTTTGTGTGGGTTTTGTATGGG + Intergenic
999119515 5:149198381-149198403 GCTTCGTGTGCAGCTTGTGCAGG + Exonic
1003261050 6:4516494-4516516 CCTGTGTGTGCATTTTGGCCAGG + Intergenic
1004872537 6:19921990-19922012 CCTTTGTGAGCATTTTCAACAGG - Intergenic
1006986824 6:38181003-38181025 CATTTGTGTACATCCTGTCCAGG - Intronic
1008136260 6:47780536-47780558 CCTTTGACTGCCTCTTGTTCTGG - Intergenic
1008710856 6:54225569-54225591 CCTTTTTGTGCAACTTCTGCTGG - Intronic
1010409912 6:75549607-75549629 CCTATGTGTGCATGATGTAGGGG - Intergenic
1010938779 6:81891295-81891317 CCTCAGTGTGCATTTTGTTCAGG + Intergenic
1013021643 6:106227004-106227026 CCTTTTTCTGCATCTTCTTCTGG - Intronic
1014989740 6:128058981-128059003 CGTGTGTGTGCATCTATTACTGG + Intronic
1015358854 6:132313127-132313149 CCTATATGTGCATGTTGTATGGG + Intronic
1016329716 6:142944485-142944507 CCATTCTGTGCCTCTGGTACTGG - Intronic
1018932069 6:168247159-168247181 CAATTGTGTGCATATTTTACAGG - Intergenic
1020535683 7:9393883-9393905 GCTTTTTCTGCATGTTGTACGGG + Intergenic
1024539764 7:50466748-50466770 CCTGTGTGGGCATCTTGTAAAGG + Intronic
1026179911 7:68029894-68029916 CCTCTGTGTGCATGTTCTACTGG + Intergenic
1030018129 7:105244804-105244826 CCTTGGCGTGCTGCTTGTACGGG - Intronic
1035837705 8:2772303-2772325 CCTTTTTGTGTTTGTTGTACAGG - Intergenic
1037859877 8:22397640-22397662 CCTTTGTCTGCAACTTGTCAGGG + Intronic
1038151579 8:24945476-24945498 CCTTTGTGTGCATCTAGGATGGG + Intergenic
1038390809 8:27198920-27198942 CCTTTGTGTAGATCTTTTCCTGG + Intergenic
1041613544 8:59879897-59879919 CCATTGTGTGCATGTACTACAGG - Intergenic
1042165443 8:65941334-65941356 CCTTTTTCTCCATCTTGTAATGG - Intergenic
1045613770 8:103880809-103880831 CCTTTGTTTTCATGTTTTACAGG + Intronic
1046928721 8:119822122-119822144 CCTTTGTGTTCATGCTATACAGG + Intronic
1049063759 8:140296712-140296734 CCTATGTTTGCATTTTGCACTGG + Intronic
1049760105 8:144328271-144328293 GCTTGGTGTGCATATTGCACAGG + Intergenic
1051528335 9:18072402-18072424 CATTTGCCTGCATCTTGTAGAGG + Intergenic
1052285754 9:26783511-26783533 CCTCTGTGTGTTCCTTGTACTGG + Intergenic
1054810307 9:69429040-69429062 CCGTTATGTGCAGGTTGTACAGG + Exonic
1059651939 9:116323108-116323130 CCTTTGTGTACATCGTGTGTGGG + Intronic
1060060472 9:120455050-120455072 CCCTTGTGTGTTTCTTGTGCTGG + Intronic
1188081871 X:25852939-25852961 CTTTTGTATGCATCTTTCACCGG - Intergenic
1189562919 X:42209336-42209358 CCTTTGTGTGCATCATGAGTTGG + Intergenic
1193464784 X:81835166-81835188 CATGTGTGTGCGTCTTGTAATGG + Intergenic