ID: 953272322

View in Genome Browser
Species Human (GRCh38)
Location 3:41457706-41457728
Sequence CTTTGTGTGCATCTTGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 170}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953272311_953272322 27 Left 953272311 3:41457656-41457678 CCAACATCAGACTCCCTCATGTC 0: 1
1: 0
2: 1
3: 19
4: 221
Right 953272322 3:41457706-41457728 CTTTGTGTGCATCTTGTACAGGG 0: 1
1: 0
2: 1
3: 15
4: 170
953272313_953272322 13 Left 953272313 3:41457670-41457692 CCTCATGTCAGCCTCCTAACTCC 0: 1
1: 0
2: 1
3: 14
4: 308
Right 953272322 3:41457706-41457728 CTTTGTGTGCATCTTGTACAGGG 0: 1
1: 0
2: 1
3: 15
4: 170
953272310_953272322 28 Left 953272310 3:41457655-41457677 CCCAACATCAGACTCCCTCATGT 0: 1
1: 0
2: 0
3: 8
4: 148
Right 953272322 3:41457706-41457728 CTTTGTGTGCATCTTGTACAGGG 0: 1
1: 0
2: 1
3: 15
4: 170
953272317_953272322 -8 Left 953272317 3:41457691-41457713 CCTGGATTTGCCACCCTTTGTGT 0: 1
1: 0
2: 0
3: 17
4: 151
Right 953272322 3:41457706-41457728 CTTTGTGTGCATCTTGTACAGGG 0: 1
1: 0
2: 1
3: 15
4: 170
953272312_953272322 14 Left 953272312 3:41457669-41457691 CCCTCATGTCAGCCTCCTAACTC 0: 1
1: 0
2: 3
3: 44
4: 434
Right 953272322 3:41457706-41457728 CTTTGTGTGCATCTTGTACAGGG 0: 1
1: 0
2: 1
3: 15
4: 170
953272315_953272322 2 Left 953272315 3:41457681-41457703 CCTCCTAACTCCTGGATTTGCCA 0: 1
1: 0
2: 1
3: 29
4: 159
Right 953272322 3:41457706-41457728 CTTTGTGTGCATCTTGTACAGGG 0: 1
1: 0
2: 1
3: 15
4: 170
953272316_953272322 -1 Left 953272316 3:41457684-41457706 CCTAACTCCTGGATTTGCCACCC 0: 1
1: 0
2: 0
3: 13
4: 147
Right 953272322 3:41457706-41457728 CTTTGTGTGCATCTTGTACAGGG 0: 1
1: 0
2: 1
3: 15
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953272322 Original CRISPR CTTTGTGTGCATCTTGTACA GGG Intronic
901307643 1:8244515-8244537 ATTTGTTTGCATATTGTCCAAGG + Intergenic
902104266 1:14020458-14020480 CTTTTTGTTCATCCTGTACAAGG - Intergenic
903286053 1:22277393-22277415 CTTTGTGTGCACCTTCTTCCTGG + Intergenic
906800422 1:48732413-48732435 CTTTATGAGCATCTTGTTCAGGG - Intronic
907240255 1:53077324-53077346 CTTGAGGTGCAGCTTGTACAGGG - Exonic
910711636 1:90188169-90188191 ATTTGTGTACATGTTGCACATGG - Intergenic
911315944 1:96356992-96357014 CTTTCTGTGCCTCTGCTACAAGG - Intergenic
911356096 1:96822648-96822670 TTTTGTGTGCAGCTTTTAGATGG - Intronic
912322390 1:108726623-108726645 CTAGGCTTGCATCTTGTACAAGG + Intronic
912891471 1:113536965-113536987 CTTTGTGTGGAGAATGTACAGGG - Intronic
914698218 1:150105511-150105533 TTTTGTGTGTCTCTTGTAAATGG - Intronic
916286459 1:163110439-163110461 CTTTGTCTGCATCATGAAAATGG - Intergenic
919616016 1:199810055-199810077 CTTTCTGTAGATCCTGTACATGG - Intergenic
920698839 1:208202601-208202623 CTGTCTGTGGATTTTGTACATGG - Intronic
921899115 1:220431765-220431787 CTTTGTTTGCATCTGGTGCTGGG + Intergenic
921908106 1:220516683-220516705 CTTTTTGTGATTCTAGTACAAGG + Intergenic
923634662 1:235683295-235683317 ATATGTGTGCAGCTTATACAAGG - Intronic
924380324 1:243457423-243457445 CTTTCTGTACATTTTCTACAGGG - Intronic
1064895413 10:20230035-20230057 CTTTGTGTTCATCTGTTATATGG - Intronic
1068333362 10:55601094-55601116 CTCTGTGAGGTTCTTGTACATGG - Intronic
1068775783 10:60866286-60866308 CAATGTGTGCATCTAGTCCATGG - Intergenic
1069537511 10:69265797-69265819 CTGAGGGTGCAGCTTGTACAGGG - Exonic
1069695559 10:70382821-70382843 CTTTGTGTGCTGCTTCTAGAGGG + Intergenic
1075311008 10:121413336-121413358 CTGTGTGTCCATCGTGTACGTGG - Intergenic
1075449569 10:122540446-122540468 CCTTGTGTGCACCCTGAACAAGG - Intergenic
1076358317 10:129868827-129868849 CTTTGATGGCCTCTTGTACATGG + Intronic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1080357614 11:31469739-31469761 TTTTGTGTGTATCCTGTTCATGG - Intronic
1084106334 11:66983212-66983234 CTTTGTGTGCCTCTCTGACAAGG - Intergenic
1087861993 11:103170087-103170109 CTTTGTGTTGTTCTTGTATAGGG + Exonic
1092168519 12:6358458-6358480 GTTTTTGTGGATCCTGTACATGG - Intronic
1092682444 12:10999818-10999840 CTGTGTGTTCTTCTTGTTCATGG + Intronic
1094349652 12:29509728-29509750 CTTTGTGGACATCATGTACTAGG - Intronic
1095206633 12:39445843-39445865 CTTTGGGTTCATATTGCACATGG + Intergenic
1095634410 12:44416097-44416119 CTTTTTGTGGATATTGTAAATGG + Intergenic
1099287672 12:80735106-80735128 CTTTTTGTTCCTCTTGTAAATGG - Intergenic
1099680362 12:85820235-85820257 ATTTGTTTACATATTGTACATGG + Intronic
1100095498 12:91029079-91029101 CTTTGTCTTCATCTTTTTCATGG - Intergenic
1100627630 12:96352279-96352301 CTTAGTGTGCCACTTGAACAGGG - Intronic
1100980910 12:100161555-100161577 CTTTGTCTGCAACCTGTACCTGG - Intergenic
1106178753 13:27353044-27353066 CTGTGTGTGCATCTGGGACCGGG + Intergenic
1106496402 13:30281825-30281847 GTTTGTGTGCATCTCGTGCAGGG - Intronic
1110462122 13:75756832-75756854 CTTTGAGTTCACCTTGTAAAGGG + Intronic
1120611802 14:86650494-86650516 TTTTGTGTGCCTATTGTAAATGG - Intergenic
1123833624 15:24166504-24166526 CTTTGTATCCATATTGTACCAGG + Intergenic
1123840365 15:24241542-24241564 CTTTGTATCCATATTGTACCAGG + Intergenic
1123853306 15:24382066-24382088 CTTTGTATCCATATTGTACCAGG + Intergenic
1123869272 15:24554647-24554669 CTTTGTATCCATATTGTACCAGG + Intergenic
1124427655 15:29575665-29575687 CTATGTGTTGATCTTGTACCTGG - Intergenic
1126967039 15:54065784-54065806 CTTTTTGTGCATCTTGGAAGAGG + Intronic
1127555384 15:60082448-60082470 CTTTGTGTGGATTTAGTACATGG + Intergenic
1128521164 15:68375721-68375743 CTTTGTGTGCATTTTAAACAGGG + Intronic
1132521446 16:391771-391793 CTTTTTGAGCACCTTCTACAAGG + Intergenic
1134384509 16:13759231-13759253 CTTTGTGTGTATCTGGCAGAGGG - Intergenic
1134879077 16:17728487-17728509 GTTTGTATCCATCTTGGACAGGG + Intergenic
1139385948 16:66571141-66571163 CTTTGTCTGCTTCCTGTACTCGG - Intronic
1144722522 17:17481293-17481315 CTTTGTTTACTTCTTGCACAGGG + Intronic
1152205973 17:78974584-78974606 CTTTGTGTGCTTCATGTGCGTGG + Intronic
1154328215 18:13407596-13407618 GTATGAGTGCATCTTGTCCAGGG + Intronic
1158340617 18:56461947-56461969 GTTTGTTTGTATCTTGTCCAAGG + Intergenic
1158823084 18:61183731-61183753 CCTTGTGTGCTTCTAGTCCAAGG + Intergenic
1160016587 18:75146177-75146199 CTTTGTGTGGCTATTGTAAATGG + Intergenic
1163329949 19:16629622-16629644 CATTGTGTACATGGTGTACATGG + Intronic
1166879556 19:45919484-45919506 CTTTGCGTGCTCCTTCTACAGGG - Intergenic
927369408 2:22337360-22337382 CTTTGTGAGGATATTTTACACGG + Intergenic
929289399 2:40172039-40172061 CTTTGCCTGCAGCTTTTACATGG - Intronic
931931225 2:67136837-67136859 CTTGGATTGCATCTTGTACTGGG - Intergenic
934997192 2:98974994-98975016 CTTTGTGTTTATCTTGTAGTTGG - Intergenic
938966113 2:136389990-136390012 CCTTATTTGCATCTTGTGCAGGG + Intergenic
939654596 2:144808017-144808039 CTGTGTATGCTTTTTGTACAAGG + Intergenic
939997538 2:148933793-148933815 CTGTGTGTGTATCATGTATATGG - Intronic
940724765 2:157324340-157324362 CTGTGTGTGCACCTTGTGAAAGG - Intronic
941143139 2:161810118-161810140 TTTTGTGTGCCTATTGTAAATGG + Intronic
942232342 2:173872252-173872274 CTTTGTGTGCATAAGGTGCACGG + Intergenic
944023341 2:195133270-195133292 CTTTGTGTGCATTGTGAACAGGG + Intergenic
946430625 2:219625384-219625406 CTTGGTGTGCAGGATGTACATGG + Intergenic
1174673094 20:52326142-52326164 CTATGTTTGCATCTTGTACCTGG + Intergenic
1175496314 20:59416928-59416950 CTTTGTGTCACTCTTGGACAAGG - Intergenic
1175684879 20:61021648-61021670 CTTTGTGTGGATTTTGGCCACGG - Intergenic
1177756360 21:25353149-25353171 TTTTGTGTGGCTCTTGTAAATGG - Intergenic
1179242593 21:39605266-39605288 CTTTCTCAGCATTTTGTACAGGG + Intronic
1183308219 22:37095316-37095338 ATTTGTGTGTGTCTTGTAGACGG - Intronic
1183946129 22:41326801-41326823 CTCTGTGTGCAGAGTGTACAAGG - Intronic
950058863 3:10052292-10052314 CTATGTGTGTCTCTTTTACAGGG + Intronic
950175994 3:10874865-10874887 CTTTGGGTGCATGTTGCACCAGG - Intronic
951421100 3:22486019-22486041 CATTCTGTGCTACTTGTACAGGG + Intergenic
953272322 3:41457706-41457728 CTTTGTGTGCATCTTGTACAGGG + Intronic
956356710 3:68401677-68401699 CTTTGTGTGTAGCTTGGACCAGG + Intronic
956662854 3:71616427-71616449 CTTTGTGTTCATCTCATAAATGG + Intergenic
957148422 3:76453997-76454019 ATTTCTGTGCAACTTATACATGG + Intronic
959228229 3:103614217-103614239 ATGTGTGTGCATCTTTTACATGG - Intergenic
959284825 3:104394281-104394303 CTTTGTATGCTTATTGTTCATGG - Intergenic
963431236 3:145207034-145207056 CTTTGTGTGCATCTTAAGTAAGG - Intergenic
967708070 3:192675657-192675679 CCTTTTGTGTATCTTGGACAAGG - Intronic
969991807 4:11272054-11272076 CCTTGTGTCCCTCTTGTAGATGG + Intergenic
970172451 4:13303425-13303447 ACTTGTGTGCATCTTGTCAATGG + Intergenic
971764665 4:30814963-30814985 CTTTGAGCCCATCTAGTACAGGG - Intronic
972803165 4:42499037-42499059 CTTTCTGTGTATTTTGTACCAGG - Intronic
973624411 4:52757047-52757069 CTTGGAGTGCAAGTTGTACAAGG + Intergenic
973713631 4:53653603-53653625 CTCTGTGTGCATTTTGGTCATGG + Intronic
975127148 4:70795581-70795603 CTGTGTGTACATATTATACAAGG + Intronic
981563014 4:146067486-146067508 GTATGTGTGCATGTTGCACAGGG - Intergenic
981643415 4:146970830-146970852 CTTTGTGTGCATGTTTTAGGTGG + Intergenic
982134193 4:152258292-152258314 CTTTGAGTGCATCTCGTCCGTGG + Intergenic
983075823 4:163325384-163325406 ATCTGTGTGCATCGTGGACATGG + Exonic
985190598 4:187368586-187368608 CTTTGTGTGTATCAAGAACAGGG - Intergenic
986310381 5:6546780-6546802 CTCTGTGTGCCACTTGTGCATGG + Intergenic
986873095 5:12074105-12074127 CTTTGGTGGGATCTTGTACAAGG - Intergenic
987404078 5:17507361-17507383 GTGTGGGAGCATCTTGTACATGG - Intergenic
987411690 5:17621064-17621086 GTGTGGGAGCATCTTGTACATGG - Intergenic
988298776 5:29395652-29395674 TTTTGACTGCATCTTGTACTAGG - Intergenic
988978340 5:36537903-36537925 CTTTGCCTGCATCATGTACCAGG + Intergenic
991190801 5:63871010-63871032 CTCTGTGTGCATCTTCTTCATGG - Intergenic
991275911 5:64845867-64845889 ATTTCTGTGCTTCTTGTACCTGG - Intronic
992524796 5:77598337-77598359 ATATGTGGTCATCTTGTACAAGG - Intronic
995867179 5:116703753-116703775 ATTTGTCAGCATCTTGTTCAAGG + Intergenic
995897657 5:117033436-117033458 CTTTGACTGCATATTGTTCAGGG + Intergenic
996032113 5:118716849-118716871 ATTTTTGTGCTTCTTGTACTTGG - Intergenic
998179095 5:139923931-139923953 CTTTGTTGGCATCTAGCACAAGG - Intronic
1001210079 5:169802624-169802646 CTTTGTTTCCATTTTATACAAGG - Intronic
1004702746 6:18094185-18094207 CTTTGTGTGTCTCTTGTAAGTGG + Intergenic
1008258179 6:49330574-49330596 CTTTGTTTGTATTTTCTACACGG - Intergenic
1010605750 6:77888136-77888158 CTTTGTATGCATCTTTGAAAGGG + Intronic
1010938780 6:81891296-81891318 CTCAGTGTGCATTTTGTTCAGGG + Intergenic
1011485806 6:87840425-87840447 CTCTGTGTGCCTCTTGTATAAGG - Intergenic
1011520080 6:88195192-88195214 GTTTGTTTGCTTCTTGTACTAGG - Intergenic
1012361369 6:98384980-98385002 CCATGTGTGCACCTTTTACAGGG - Intergenic
1013445993 6:110227516-110227538 TTTTGTGCCCATCTTGAACAAGG + Intronic
1014081716 6:117294702-117294724 CTTTATGTGGCTCTTGTAAATGG - Intronic
1014888022 6:126805827-126805849 CTTTTTTTTCATCTTGTAAATGG + Intergenic
1016901747 6:149109613-149109635 GTTTGTGTGCATTTTTTTCAAGG - Intergenic
1017306205 6:152921641-152921663 CTTTGTCTGCCTCTTTTTCATGG - Intergenic
1017355312 6:153498867-153498889 TTTTGTGTGACTCTTGTAAATGG - Intergenic
1017937791 6:159021774-159021796 GTTTGTGTGCATGTGGTTCACGG - Intergenic
1017983889 6:159425693-159425715 GTTTGTGTGCACCTTCTGCAAGG - Intergenic
1018066606 6:160129003-160129025 CTTTGTCTGCATCAAGTCCATGG - Intronic
1019315689 7:384809-384831 GTTTGTTTGCATTTTGTATAAGG - Intergenic
1021107988 7:16660922-16660944 ATTTGTCTGCATATTGTCCATGG + Intronic
1022223275 7:28336171-28336193 CTTTGTGTGGTTTTTGTATAAGG + Intronic
1022577613 7:31513550-31513572 AATTTTGTGCATCTTGTATATGG + Intergenic
1023068623 7:36404411-36404433 CTTTCTGTGCATCTTCCACCTGG + Intronic
1023850067 7:44145496-44145518 CCTGGGGTGCAGCTTGTACACGG + Exonic
1028073989 7:86488012-86488034 CTTTGTGAGGAACTTGAACATGG + Intergenic
1032314502 7:130822230-130822252 CTTTTTGTTCATCTTGCTCAGGG + Intergenic
1035348070 7:158220612-158220634 CTTTTTGTACATGTTGTAAATGG - Intronic
1035544798 8:471829-471851 CTGTGTGTGCGTACTGTACAGGG + Intergenic
1035626312 8:1073664-1073686 CTGTGTGTGCATTTTGTAGATGG + Intergenic
1035837704 8:2772302-2772324 CTTTTTGTGTTTGTTGTACAGGG - Intergenic
1036651633 8:10647793-10647815 CTGTTTGTACATCTTGTTCATGG - Intronic
1037951695 8:23022830-23022852 CTTTATCAGCATCGTGTACAAGG + Exonic
1038151580 8:24945477-24945499 CTTTGTGTGCATCTAGGATGGGG + Intergenic
1038617532 8:29108925-29108947 ATTTATGTGCATATTGAACATGG - Intronic
1039097916 8:33906844-33906866 CTTTATGTTTATCTTGTTCAAGG + Intergenic
1040881883 8:52214254-52214276 CTTTGTGTTCATGTTATAGATGG - Exonic
1041886787 8:62818438-62818460 CTTTCCATGCATCATGTACAGGG - Intronic
1043425534 8:80144770-80144792 TTTTGTGTGCATTTTTTACATGG + Intronic
1044036521 8:87310369-87310391 TTTTGTGTGGATATTGTAAATGG - Intronic
1044505514 8:93012998-93013020 CTTTGTGTGCATAGTGTGAAGGG + Intronic
1044630225 8:94271390-94271412 CTTCCTGACCATCTTGTACAGGG - Intergenic
1044877421 8:96683531-96683553 GTTTTTGTGCTTCTTGTACCTGG + Intronic
1047559715 8:125973379-125973401 TTTTGTGTGCATCATGTACATGG - Intergenic
1047636457 8:126768497-126768519 CTTGGAGTCCATCTTGGACATGG - Intergenic
1048301537 8:133254828-133254850 TTTGCTGTGCATCTTGTGCATGG - Intronic
1048492877 8:134911130-134911152 CTTTGATTGCTTCTTGCACAAGG + Intergenic
1048624540 8:136170809-136170831 ATATGTGTGCATCTTGTTCTAGG + Intergenic
1049733586 8:144191815-144191837 CTCTGCGTGCTTCTTGTAGAGGG - Exonic
1049760106 8:144328272-144328294 CTTGGTGTGCATATTGCACAGGG + Intergenic
1051966898 9:22839134-22839156 CTTTTTTGGCATATTGTACAAGG + Intergenic
1054810308 9:69429041-69429063 CGTTATGTGCAGGTTGTACAGGG + Exonic
1056926835 9:90842660-90842682 CATAGTGTGCATGTAGTACATGG + Intronic
1058886642 9:109326704-109326726 CTCTGTGTGCATCTTCCATATGG - Intergenic
1059854852 9:118385126-118385148 CTTAGTGTTCATTTTGCACAGGG - Intergenic
1185747688 X:2584976-2584998 CTCTCTGTGTCTCTTGTACAGGG + Intergenic
1186839918 X:13475112-13475134 ATTTGTGTGCATCTTTTAGCTGG - Intergenic
1187553564 X:20329958-20329980 CTTTGAATGGATCTTTTACATGG - Intergenic
1190667215 X:52706508-52706530 CTTTTTGTGTATTTTGTAGACGG - Intronic
1190672203 X:52751900-52751922 CTTTTTGTGTATTTTGTAGACGG + Intronic
1193632978 X:83912305-83912327 CCTGGTGTGCATCTTCTACCTGG - Intergenic
1195201789 X:102558193-102558215 CTTTATGTACAGCTTGCACAGGG + Intergenic
1195412932 X:104588309-104588331 CTTTCTGAGCAGCATGTACAAGG + Intronic
1195593840 X:106665221-106665243 CTTTAAGTGTATCTTATACAAGG + Intronic
1196260765 X:113577989-113578011 CTTTCTGTGCATGCTTTACATGG - Intergenic
1197387935 X:125823541-125823563 CTGTGAGTGCATCTTGTCCAAGG + Intergenic
1199790020 X:151144499-151144521 TTTTGTGTGGATATTGTAAATGG - Intergenic
1200652931 Y:5864437-5864459 CTTTGAATCCATCTTGTCCAGGG + Intergenic
1201397982 Y:13570194-13570216 CTTTTTGTGAATATTGTAAATGG + Intergenic
1201553824 Y:15247821-15247843 GTTTGTTTGCTTCTTGGACAGGG - Intergenic