ID: 953273061

View in Genome Browser
Species Human (GRCh38)
Location 3:41465027-41465049
Sequence AGTCACCAGCTCCCAAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953273058_953273061 1 Left 953273058 3:41465003-41465025 CCAAGCTCTGATTTTACACACTG 0: 1
1: 0
2: 2
3: 26
4: 269
Right 953273061 3:41465027-41465049 AGTCACCAGCTCCCAAGGGAAGG 0: 1
1: 0
2: 2
3: 21
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953273061 Original CRISPR AGTCACCAGCTCCCAAGGGA AGG Intronic
900163281 1:1234649-1234671 AGTCCACAACTCCCACGGGAGGG - Exonic
900306478 1:2011684-2011706 AGACAACAGCCCCCAAGTGATGG + Intergenic
901079921 1:6578320-6578342 AGCAGCCTGCTCCCAAGGGAGGG - Intronic
903170585 1:21550258-21550280 AGTCACCCCCTCCAGAGGGAGGG - Intronic
903173224 1:21566201-21566223 AGTCCCCAGCACCCAGGGGGTGG - Intronic
903366506 1:22808506-22808528 ACTCACCAGCTCCCAGGAGTTGG - Intronic
904794567 1:33049629-33049651 AGTCGCCAGCTTCCAAGAAAAGG + Intronic
904988988 1:34576289-34576311 AGTCACCATCTCACATGGGAAGG + Intergenic
907840769 1:58155188-58155210 ATTCAGCTGCTGCCAAGGGAAGG + Intronic
907841538 1:58162798-58162820 ATTCAGCTGCTGCCAAGGGAAGG + Intronic
908558773 1:65284367-65284389 AGCCTCCAGCTCCCCAGGGTAGG + Intronic
912652324 1:111450147-111450169 TGTCATAAGGTCCCAAGGGAAGG - Intronic
912690793 1:111803215-111803237 TGTCACCAGCTCACATGGGGTGG - Intronic
916735453 1:167603194-167603216 AGTGACTTGCACCCAAGGGAAGG + Intergenic
918602058 1:186375532-186375554 GGTCACCAGCTCTTCAGGGAGGG - Intronic
1063096323 10:2912319-2912341 AGACATCACCTCCCAAGAGAAGG + Intergenic
1063441860 10:6079292-6079314 ACTCCCCAGCTCACAGGGGAGGG - Intergenic
1067475091 10:46559503-46559525 AGTCACCAGGTGACAAAGGATGG + Intergenic
1068384290 10:56304423-56304445 AGTCACCAGCTGTCAAAGGGAGG + Intergenic
1069050395 10:63786387-63786409 TGTCACTAGCTCCTAAGGCAGGG - Intergenic
1070554812 10:77519289-77519311 TATCACCAGCTGCCAATGGAGGG - Intronic
1072315698 10:94200872-94200894 AGTCACCAAATCCCAAGTTAAGG + Intronic
1073206955 10:101774629-101774651 GGTCCCCAGCTCAGAAGGGAAGG - Intronic
1073514272 10:104062947-104062969 AAAAACCAGGTCCCAAGGGAAGG - Intronic
1074057978 10:109939806-109939828 AGTCACAAGCTCCCTAGCCAGGG - Intergenic
1074869814 10:117567756-117567778 TGTCAGCAGCTCCTAGGGGATGG - Intergenic
1075097630 10:119483020-119483042 AGTCCCCACGTCTCAAGGGAGGG + Intergenic
1076719181 10:132385753-132385775 AGGCACCAGTTCCCGAGGGAAGG - Intergenic
1076939472 10:133591904-133591926 AGTCACCACCACTCCAGGGATGG - Intergenic
1078665118 11:13318073-13318095 AGAAACAAGCTCCCAGGGGAGGG - Intronic
1079434210 11:20429422-20429444 AGTCCCCAGCCCCCAAGCCAGGG - Intronic
1080137799 11:28877553-28877575 AGTCAGCAGCACATAAGGGAAGG - Intergenic
1080448384 11:32358102-32358124 AGTAACCTGCTACCAAGCGAAGG - Intergenic
1083805713 11:65072626-65072648 TGTCCCCAGCTCCCACTGGAGGG + Intronic
1083852856 11:65378066-65378088 AGGCCCCATCTCCCAAGGGATGG - Intronic
1084457841 11:69278610-69278632 AGCCACCAGAGCCCAAGTGAGGG + Intergenic
1084470629 11:69357110-69357132 GTGCACCAGCTCCCATGGGAGGG - Intronic
1091451901 12:577586-577608 AGTCACCAGATACTGAGGGATGG + Intronic
1092757823 12:11780659-11780681 AGTGACCAATTCCCCAGGGATGG - Intronic
1096106643 12:48999881-48999903 AGTAACCAGCTCCCATGCGGTGG + Intergenic
1096626958 12:52901794-52901816 AGTCCCAAGGTCCCAAGGGGTGG + Intronic
1099618546 12:84972158-84972180 AGTCACTTGCTCCCGAGGAAAGG + Intergenic
1101353944 12:103959162-103959184 AAACACCAGCTCCAAAGGAATGG - Intronic
1101814997 12:108139368-108139390 AGTCCCCAGTTCACAAGGGCTGG - Intronic
1103598263 12:122037480-122037502 AGTCACCAGCTCCAAGGGCAGGG + Intronic
1104405503 12:128513189-128513211 AGCCACCTGCTCACAGGGGAAGG + Intronic
1104931227 12:132340494-132340516 ACTCACCCACTGCCAAGGGAGGG - Intergenic
1112382478 13:98905429-98905451 AGAAACCACCTCCCAAGGGAAGG + Intronic
1112404222 13:99103772-99103794 ATTCAGCAGCTGCCAAAGGAGGG - Intergenic
1113993795 14:16051027-16051049 ACTCACCAGTTACCAGGGGATGG + Intergenic
1116781242 14:49240328-49240350 AGTCACACTCTCCCTAGGGAGGG - Intergenic
1118824883 14:69371130-69371152 AGTCACCAGCTGCTCAGGCAAGG - Intergenic
1118923139 14:70168092-70168114 AGTCATCACCTCTCAAGAGAGGG - Exonic
1119566863 14:75636300-75636322 CGTCGCCACCTCCCTAGGGATGG - Intronic
1119763781 14:77175117-77175139 AGACACCAACTCCCAGGGGAAGG + Intronic
1121427144 14:93860408-93860430 AGCCATCACCTCCCAAGGCAGGG - Intergenic
1122297801 14:100714926-100714948 AGTCAACAGGTCCATAGGGAAGG + Intergenic
1122645390 14:103189995-103190017 AGGCCCCTGCTCCCAGGGGAAGG - Intergenic
1125508167 15:40279245-40279267 AATCGGCAGGTCCCAAGGGAAGG + Intronic
1127288749 15:57552350-57552372 TGTCAACAACTCCCAGGGGATGG + Intergenic
1128112537 15:65085774-65085796 TGTCACCCCCTCCCAAGTGAGGG + Intergenic
1128307048 15:66605514-66605536 AGTCACCAGCTGCCAGAGGATGG - Intronic
1129388912 15:75210836-75210858 AGTCACCGGCCCCCAAGGTCAGG + Exonic
1129719075 15:77868064-77868086 AGTAAGCAGCTCCCTGGGGAAGG + Intergenic
1129876781 15:78980808-78980830 GGCCCCCAGATCCCAAGGGAAGG - Intronic
1130459857 15:84152808-84152830 AGTAAGCAGCTCCCTGGGGAAGG - Intergenic
1130772795 15:86941754-86941776 AGTCAGCAGCTCTCAATGGCTGG - Intronic
1131792637 15:95981624-95981646 AGTCACCCGCCACTAAGGGACGG - Intergenic
1132024489 15:98393170-98393192 AGTCACCACCGGCCCAGGGAAGG + Intergenic
1132651124 16:1021856-1021878 AGACTCCCGCTCCCTAGGGAAGG - Intergenic
1133127082 16:3654182-3654204 AGTGACCAGGTCACAAGGGCAGG - Intronic
1135045181 16:19149503-19149525 AGTCCCCAGGTGTCAAGGGAGGG + Intronic
1135821679 16:25691749-25691771 CGTCCCGAGCTCCCAAGGGAGGG + Intergenic
1139204145 16:65009845-65009867 AGCCACCAGCTCGAAAGGGAAGG + Intronic
1141544819 16:84758854-84758876 AGTCACATGCACCCAAAGGAGGG - Intronic
1141939572 16:87265892-87265914 GATCACCAGCTTCCAAGGGAGGG + Intronic
1144636401 17:16911904-16911926 AGTCACAAGCACACAAGAGAAGG + Intergenic
1146368790 17:32251010-32251032 TGTGACCATTTCCCAAGGGAAGG + Intronic
1147557458 17:41488566-41488588 CATCACCAGCTCCCAAAGGCAGG + Intronic
1151869479 17:76826771-76826793 ATTCACCAGCTTCCAGGAGATGG + Intergenic
1152324888 17:79630125-79630147 AGGTACCAGCTCACAGGGGAAGG + Intergenic
1152555728 17:81052301-81052323 AGCCAACATCTCCCGAGGGAAGG - Intronic
1153212868 18:2787249-2787271 ATTCACTCACTCCCAAGGGATGG + Intronic
1153241199 18:3032968-3032990 AGTCACAAGCAAACAAGGGATGG - Intergenic
1154031725 18:10759010-10759032 GATCACCAGCTGCCATGGGAAGG + Intronic
1154141172 18:11826155-11826177 ACTCACCATCCCCCATGGGATGG + Intronic
1155522679 18:26685057-26685079 ATTCACCAGCTTCCATGGAATGG - Intergenic
1157656966 18:49399849-49399871 AGTCTCCAGCCCTCAAGGCAAGG + Intronic
1157828468 18:50834116-50834138 ACTCCCCAGCCCCCAAGGCAGGG + Intergenic
1160209239 18:76862408-76862430 TGCTGCCAGCTCCCAAGGGACGG - Intronic
1160783922 19:891138-891160 AGTCACCAGCTCCTGCGGGAGGG + Exonic
1162393635 19:10404077-10404099 AAACCCCAGCTCCCAAGGCAGGG - Intronic
1164743687 19:30595243-30595265 TGTTGCCAGCTCCCAAGTGATGG - Intronic
1165808735 19:38597465-38597487 AGGTACCAGCTCCCAATGAATGG - Exonic
1167851052 19:52202276-52202298 AGTCACCAGCTTCCAACTGTTGG - Intronic
925094194 2:1182122-1182144 AGGCACCATCTCCCAAGGCGAGG - Intronic
925550750 2:5071483-5071505 TGTCACCAGCTACACAGGGAGGG + Intergenic
925978450 2:9157224-9157246 AGTTCTCAGCTCCCAGGGGAAGG - Intergenic
926829453 2:16945030-16945052 AGTCACCAGCACACAGGTGATGG - Intergenic
927096543 2:19751534-19751556 ACACACCGGCGCCCAAGGGAAGG + Intergenic
927336223 2:21927889-21927911 AATCACCACCTGTCAAGGGAGGG + Intergenic
929950689 2:46407485-46407507 AGTCACCAGCACCAAAGGGGAGG + Intergenic
930164074 2:48186502-48186524 ATTCACCAGCTAACAAGGGAAGG + Intergenic
931752571 2:65343791-65343813 AATCATCACCTCCCAAGGGTGGG - Intronic
932024182 2:68116820-68116842 TGTCAGCAGCTCCCATGGGTAGG + Intergenic
932352998 2:71046891-71046913 ATAAACCAGCTGCCAAGGGAGGG - Intergenic
933104800 2:78310908-78310930 AGTTACCAGGTCCTAAGGGGTGG - Intergenic
934158220 2:89222933-89222955 ACTCACCAGGTGCCAGGGGAGGG - Intergenic
934209044 2:89959491-89959513 ACTCACCAGGTGCCAGGGGAGGG + Intergenic
934514204 2:94974723-94974745 ATCCATCAGCCCCCAAGGGAGGG - Intergenic
934919312 2:98330115-98330137 AGTCACCATCTTCCAAGGGAGGG + Intergenic
934990437 2:98916750-98916772 AGACAGCAGCTCCCCAGAGAAGG + Intronic
938341533 2:130539588-130539610 TGTCTCCAGCTCCTCAGGGAGGG - Exonic
938348297 2:130581121-130581143 TGTCTCCAGCTCCTCAGGGAGGG + Intronic
938383454 2:130849107-130849129 AGGCCCCAGATCCCAAGGGAGGG - Intronic
938537890 2:132259845-132259867 ACTCACCAGTTACCAGGGGATGG - Intergenic
938781379 2:134587954-134587976 AATCACCACATCCAAAGGGAAGG + Intronic
939275831 2:139994480-139994502 AATCAGCAGCTCCAAGGGGAGGG + Intergenic
939780790 2:146445149-146445171 AATCACCAGCTCTCTAGGTAAGG + Intergenic
942389771 2:175479761-175479783 AGTCACCAGCTCAGAGGGGAGGG - Intergenic
944542274 2:200765630-200765652 AGACACCAGCTTCAAATGGAGGG + Intergenic
947336214 2:229087419-229087441 AGTCACTATCTCCCAAGGGTAGG - Intronic
948587625 2:239029060-239029082 TGTCACCGACTCCCAAAGGAGGG - Intergenic
1168829487 20:837437-837459 AGTGCCCAGCTCCTGAGGGAGGG - Intronic
1169073241 20:2746501-2746523 TGCCACCAGCTCCCAAGGAGGGG + Intronic
1170682687 20:18540563-18540585 AGTCACCAGATGCCCAGGTATGG + Intronic
1170735291 20:19008963-19008985 AGGCACCATCTCACAAGAGATGG - Intergenic
1171811356 20:29746050-29746072 ACTCACCAGTTACCAGGGGATGG - Intergenic
1171908308 20:30919690-30919712 ACTCACCAGTTACCAGGGGATGG + Intergenic
1172482594 20:35279739-35279761 AGTCCCCGCCTGCCAAGGGATGG + Exonic
1172513633 20:35517291-35517313 AGGGTCCAGCTGCCAAGGGAAGG + Exonic
1175648006 20:60692458-60692480 AAACACCAGCTCCAAAGGAATGG + Intergenic
1176199759 20:63854989-63855011 TGGCGCCAGCTCCCCAGGGACGG + Intergenic
1176375730 21:6086122-6086144 AGTCACCGGCTCCCTCGGGGAGG + Intergenic
1178883548 21:36467114-36467136 GATCACCAGCTCTGAAGGGAGGG + Intronic
1178911927 21:36681703-36681725 AATCACCAGGTGTCAAGGGAGGG + Intergenic
1179501487 21:41812115-41812137 AGACTCCACCTTCCAAGGGAGGG + Intronic
1179747744 21:43452122-43452144 AGTCACCGGCTCCCTCGGGGAGG - Intergenic
1180313473 22:11256486-11256508 ACTCACCAGTTACCAGGGGATGG - Intergenic
1180341746 22:11625852-11625874 ACTCACCAGTTACCAGGGGATGG + Intergenic
1182131510 22:27856399-27856421 AGTCACCAGCTCCACAGCGGAGG + Intronic
1183287030 22:36973276-36973298 TTTCAAGAGCTCCCAAGGGAGGG + Intergenic
1184297487 22:43534131-43534153 AATCACCAGTTGTCAAGGGAGGG + Intronic
1185365615 22:50435335-50435357 AGTCACCAACTACCCCGGGAGGG - Intronic
952298198 3:32080221-32080243 AAACACCAACTCCAAAGGGATGG + Intergenic
953273061 3:41465027-41465049 AGTCACCAGCTCCCAAGGGAAGG + Intronic
954626346 3:52023975-52023997 AGGCCCCAGGTCCCCAGGGAGGG + Intergenic
954700801 3:52449971-52449993 ATTCTCCAGCTCACAAGGGCAGG + Intergenic
954712618 3:52512585-52512607 TGCCTCCAGCTCCTAAGGGAAGG - Exonic
955936596 3:64108601-64108623 TGCAACCAGCTCCCAAGGGATGG - Intronic
957717979 3:83956667-83956689 ACTCTCCAAGTCCCAAGGGAGGG - Intergenic
958020419 3:87988139-87988161 AGTCACCAGCTCGAGAGGGTGGG + Intergenic
958040611 3:88221875-88221897 AGTCACCAGCTCCAACAGGGAGG - Intergenic
960619528 3:119625260-119625282 AGTAACCAACTCCTAAGGGGAGG - Intronic
961415400 3:126753062-126753084 TGCCACCAGCTACCAAGAGAAGG - Intronic
966008171 3:175042878-175042900 ACTCACTAACTCCCTAGGGAGGG - Intronic
971537177 4:27767842-27767864 AATCCCCAGCTCCCAAGAGGTGG - Intergenic
986318807 5:6610885-6610907 ACTCACCAGCTCACCAGGGATGG + Intronic
986659478 5:10046159-10046181 AGTCATCATCTCCAAAGGGCAGG - Intergenic
986786437 5:11118605-11118627 AGACCCCAGCTCTCTAGGGAGGG + Intronic
987456174 5:18149889-18149911 ATTCACTTGCTCCCAAGGAAAGG - Intergenic
990314855 5:54574411-54574433 AGACCCCAGCTCCCAAAGGTAGG + Intergenic
990943022 5:61222606-61222628 AGTCCCCACGTGCCAAGGGAGGG + Intergenic
992828034 5:80569308-80569330 ACGCACCATTTCCCAAGGGAGGG - Intronic
993933864 5:93976491-93976513 AATCCCCACCTCTCAAGGGAGGG + Intronic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
998521809 5:142807799-142807821 AGTCCCCAGTTCCCAAGGACAGG - Intronic
1001242922 5:170083789-170083811 TGTCACCGGCTCCCAAGTGGTGG + Intergenic
1001444590 5:171773537-171773559 GGGCACCAGCTCCCATGTGAGGG - Intergenic
1006830886 6:36967564-36967586 AGTCACCCCCGCCAAAGGGAAGG - Intergenic
1007109634 6:39305462-39305484 AGTCATCAGCTGCCTAGGGGAGG + Intronic
1007352656 6:41285128-41285150 ATTTGCCAGCTCCCCAGGGAAGG + Intronic
1012415895 6:99013408-99013430 AGTCACTAGCTCCATAAGGAAGG + Intergenic
1014036154 6:116768954-116768976 AATGACCCGCTCCCAAAGGAAGG + Intergenic
1014745436 6:125194932-125194954 AAACACCAGCTCCAAAGGAATGG + Intronic
1016742545 6:147543030-147543052 GGTCACCAGCTCCCCTGGGCAGG + Intronic
1017908369 6:158772185-158772207 GGCCATCAGCTCCCAAGGGCAGG + Intronic
1019523240 7:1469783-1469805 AGGCACCAGCTCCCAGGGGAGGG - Intergenic
1019549764 7:1596108-1596130 AATCCCCAGCTCCTAAGGGTTGG - Intergenic
1020785851 7:12571238-12571260 AGTCACCAGCTCCAAAGTCCAGG - Intronic
1022391246 7:29946518-29946540 AGTCACAAGCTCCGAAGACAGGG - Intronic
1022542652 7:31153143-31153165 AATCACCAGAGCCCGAGGGAGGG - Intergenic
1024673868 7:51620844-51620866 AGTCACCAGCTTCCTTGGAAAGG + Intergenic
1028112831 7:86963401-86963423 AAAATCCAGCTCCCAAGGGAAGG + Intronic
1028338870 7:89693383-89693405 AGTCACCAGGATACAAGGGAAGG + Intergenic
1029733281 7:102451671-102451693 AGTCAGCAGATGCCACGGGAGGG - Exonic
1030812806 7:113996134-113996156 AGACACCATCTCCAAAAGGAAGG - Intronic
1033038389 7:137896075-137896097 AATCACCAGCTCCCCATGGCTGG + Intronic
1033275888 7:139971395-139971417 AGTCACAAGTTCCCAAAGCAGGG + Intronic
1033451351 7:141464892-141464914 AGAACCCAGCTCCCAAAGGAAGG + Intronic
1034735486 7:153425540-153425562 ACTCACTTGCCCCCAAGGGAGGG - Intergenic
1035344231 7:158188095-158188117 CGTCACGAGCTCCCAACGGAAGG + Intronic
1039083852 8:33760337-33760359 ACTCAGCAGCTCCCAGGGGTTGG + Intergenic
1039637209 8:39179843-39179865 AGTCCCCAGCTCTCATGGAAAGG - Intronic
1039789016 8:40859272-40859294 CGTCACCAGCTGACAAGGGTGGG - Intronic
1040016504 8:42704757-42704779 AGACACCATCTCACAATGGATGG - Intronic
1049418286 8:142505450-142505472 TGTCCCCATCTCCCAGGGGAGGG - Intronic
1051662792 9:19441420-19441442 AGTGATCAGCTCACAGGGGAAGG - Intronic
1053108698 9:35438097-35438119 GGTCACCACATCCCAAGGAAGGG + Intergenic
1056163421 9:83920767-83920789 AGTCACCTGCCTCCGAGGGAGGG + Intronic
1056197516 9:84242403-84242425 AGGGAACAGCTCCGAAGGGAGGG + Intergenic
1056942085 9:90964676-90964698 AGCCATCATCTCCCAGGGGACGG + Intergenic
1057158678 9:92868758-92868780 ACTCACCACCTCCCCAGAGAGGG + Intronic
1057179272 9:93021191-93021213 AGCCACCATCTCCCAGGGCACGG - Intronic
1058712586 9:107693727-107693749 ATTCTCCAGCTCCAAAGGGTTGG - Intergenic
1060492558 9:124095616-124095638 AGTCACCATCTCCCCAAGGGTGG + Intergenic
1061488635 9:130933395-130933417 AGCCCCCAGCTCCCAAGACAGGG + Intronic
1203361985 Un_KI270442v1:223926-223948 ACTCACCAGTTACCAGGGGATGG - Intergenic
1187862013 X:23691898-23691920 AGACACCAGCTCCCAAGTACAGG + Intergenic
1190898920 X:54650266-54650288 ATGCACCAGCTGCCAAGGGATGG - Intergenic
1196702831 X:118690266-118690288 ACTCACCAACTCCCAAGACAGGG - Intergenic
1198275493 X:135094896-135094918 GGTCACCGGCTCCCATGGCAAGG - Intergenic
1198311029 X:135425822-135425844 GGTCACCAGCTCCCATGGCCAGG + Intergenic
1200157345 X:153984295-153984317 AGTGACCAGCTCCAAAGGTGAGG + Intergenic
1201076456 Y:10193616-10193638 ACTCACCAGTTACCAGGGGATGG + Intergenic
1202379387 Y:24262358-24262380 AGTAAGCAGCTCCCTGGGGAAGG + Intergenic
1202491395 Y:25407763-25407785 AGTAAGCAGCTCCCTGGGGAAGG - Intergenic
1202498265 Y:25461672-25461694 AGTCTGCAGCTCCAGAGGGAAGG + Intergenic