ID: 953274902

View in Genome Browser
Species Human (GRCh38)
Location 3:41485259-41485281
Sequence TCATCTAGCAAGTTTAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953274896_953274902 22 Left 953274896 3:41485214-41485236 CCTGTAACTAAAATGACAGAAAA 0: 1
1: 0
2: 4
3: 48
4: 545
Right 953274902 3:41485259-41485281 TCATCTAGCAAGTTTAAAGTGGG 0: 1
1: 0
2: 2
3: 8
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953274902 Original CRISPR TCATCTAGCAAGTTTAAAGT GGG Intronic
904500668 1:30911024-30911046 TCATTTAGCAAGCATAAATTGGG + Intergenic
907620528 1:55973613-55973635 TGATCTAGTAAGTTTCAACTGGG - Intergenic
907996739 1:59640486-59640508 TCATGGAGTATGTTTAAAGTTGG + Intronic
910230739 1:84983973-84983995 TTATTTAGAAATTTTAAAGTAGG - Intronic
910725848 1:90337979-90338001 TCCTCCAGCAAGTGGAAAGTAGG - Intergenic
911179370 1:94847588-94847610 TCCTCTAGCGAGCTTGAAGTGGG + Intronic
911973247 1:104462832-104462854 TCAACAAACATGTTTAAAGTGGG - Intergenic
914854001 1:151336866-151336888 CCAGCTAGAATGTTTAAAGTTGG + Intergenic
915151808 1:153839193-153839215 TCCAACAGCAAGTTTAAAGTTGG - Intronic
916195305 1:162216923-162216945 ACATATAGCAAATTTAAAGGTGG + Intronic
916294480 1:163202457-163202479 TAATCTAGACAGTTTAATGTTGG + Intronic
923058626 1:230449306-230449328 TTTTCTACCAAGTTTAAAGAAGG - Intergenic
1063760905 10:9074629-9074651 TCTTCTATTAATTTTAAAGTAGG + Intergenic
1071757292 10:88557661-88557683 TCAACTACTAATTTTAAAGTAGG - Intronic
1075188786 10:120287048-120287070 TGATCTAGCTTGTTTACAGTGGG + Intergenic
1078109982 11:8384572-8384594 TCTTCTAGGAAGTTAAAAGGAGG - Intergenic
1079724112 11:23858546-23858568 TCTTATAGTAAGTTTGAAGTTGG - Intergenic
1080299095 11:30764287-30764309 TCTTTTAGCAAATTTAAATTAGG + Intergenic
1080698199 11:34621293-34621315 TCATCTGTCCAGTTTAAAGCAGG - Intronic
1081089860 11:38850191-38850213 CAATCTACCAAGTTTAAACTAGG - Intergenic
1081406042 11:42699142-42699164 TTGTTCAGCAAGTTTAAAGTGGG + Intergenic
1081506301 11:43720732-43720754 GCACCTAGTAAGTTTAAACTTGG + Intronic
1081794455 11:45809964-45809986 TCATCTGTCAAGGTCAAAGTTGG - Intronic
1085493582 11:76946259-76946281 TCATTTAGAAAGTTTAATGCTGG - Intronic
1086531395 11:87790097-87790119 TCTTCTACAAAGTTTAAAGAAGG + Intergenic
1091961227 12:4696316-4696338 TCATTTAGCAAATTTAAATAAGG - Intronic
1092801616 12:12173787-12173809 TCAACTAGCAATTTTCAAATAGG + Intronic
1093192267 12:16088421-16088443 TCATCTAGCAATTTTGGAATTGG - Intergenic
1093906570 12:24700083-24700105 TCATCTACCACGATTAAAGGAGG + Intergenic
1094263139 12:28524450-28524472 TAATCCAGCATGATTAAAGTGGG - Intronic
1097316129 12:58173262-58173284 TTAATTGGCAAGTTTAAAGTTGG - Intergenic
1097929952 12:65171772-65171794 TCATTTAGCAAGTAAATAGTAGG - Intronic
1099015147 12:77335615-77335637 TCATCTAAGAAGTTAAAAGAAGG + Intergenic
1100247958 12:92783130-92783152 CCAACTAGCTAGTTTCAAGTTGG - Intronic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1104863433 12:131937984-131938006 TCATCTAACATGTCCAAAGTAGG + Intronic
1107779278 13:43880195-43880217 TCATTTAGCCAGTTTTGAGTGGG - Intronic
1109384907 13:61615654-61615676 TCATCTTTGAAGTGTAAAGTTGG + Intergenic
1109971226 13:69771335-69771357 TCATCTATTATATTTAAAGTTGG + Intronic
1110977145 13:81853171-81853193 TCATCTAGCAATTTATAATTGGG - Intergenic
1112417096 13:99212177-99212199 ACATCAAGCAATTTTAAAATTGG + Intronic
1112694427 13:101931812-101931834 ACATGTAGGAAGTTTAAAATGGG - Intronic
1114504281 14:23197058-23197080 TCATTCAGCAATTTTAAATTGGG - Intronic
1117414686 14:55483857-55483879 TCATGTAGAAAGTTTAAAGTAGG + Intergenic
1118338017 14:64871177-64871199 TAATTTAGCAAGTTTGAAGAAGG + Intronic
1119316590 14:73701192-73701214 TGATCTAGCAAATTTAACATAGG + Exonic
1120003052 14:79325385-79325407 TCCTCCAGCAAGAGTAAAGTGGG - Intronic
1120334670 14:83139675-83139697 TGATCTAGAAATTTTAAAGCAGG - Intergenic
1120642226 14:87029129-87029151 TCACCTGGCAAGTTGAGAGTGGG + Intergenic
1126459939 15:48904243-48904265 TCATCTAGCAAGTCAATAGGTGG - Intronic
1127473716 15:59313007-59313029 TCATTTAGCAGGTTTAGGGTGGG - Intronic
1127667776 15:61165728-61165750 TCAGCTTTCATGTTTAAAGTGGG - Intronic
1128009994 15:64283781-64283803 CCATCAAGAAAGTTAAAAGTTGG - Intronic
1128230083 15:66028342-66028364 TAATCTAGGAAGTGTAAAATAGG - Intronic
1129830321 15:78665170-78665192 CCATCTAGCAAGTTTTATTTTGG + Intronic
1135062643 16:19284052-19284074 TCATCTTGCAAGCTGAAATTTGG - Intergenic
1138177436 16:54913619-54913641 TCATATATAAAGTTTAAAGATGG + Intergenic
1139020476 16:62742733-62742755 TGATTTAGAAAGTTTAAAATGGG - Intergenic
1140303264 16:73778875-73778897 GCATCTGGGAAGTTGAAAGTAGG + Intergenic
1153690608 18:7589492-7589514 CTATCTAGAAAGATTAAAGTTGG - Intronic
1154041442 18:10859944-10859966 GCAGCTAGGAAGTTTAAAGTGGG + Intronic
1155314742 18:24560376-24560398 TCATCTAGGACTTTTAAATTAGG - Intergenic
1157344652 18:46814841-46814863 ACATATAGCAACTTTAAACTGGG + Intronic
1157877620 18:51288179-51288201 TCATTTTGCAAGTTTAAAACAGG - Intergenic
1160491473 18:79340167-79340189 TAATCTAGCACATATAAAGTAGG - Intronic
1162217202 19:9146278-9146300 TCATCTAGCTGGTTGAAAGGAGG + Intronic
1164546666 19:29171067-29171089 TCATTTACCAAGTTAAAATTTGG - Intergenic
1164602839 19:29575015-29575037 TCCTATAGCATGTTTAAAATAGG + Intergenic
1167129557 19:47575034-47575056 TCATTTAGCAAGTTTTTATTGGG + Intergenic
925385035 2:3456090-3456112 GAATCTAGCCAGTTTAAACTAGG - Intronic
925625138 2:5835226-5835248 TCATCTAGCAATTTTACTGCTGG + Intergenic
926558576 2:14389509-14389531 TCATATAGCATGTTGAAACTAGG + Intergenic
926902348 2:17766606-17766628 TCATCTATCAAGAGTAAACTAGG + Exonic
927251959 2:21003889-21003911 TCATCTAGCAATTCTATTGTGGG + Intronic
930185830 2:48411148-48411170 TCAGCTTGCAAGCTTGAAGTAGG + Intergenic
930252440 2:49049975-49049997 ACACCTAGCAAGTTAAAAATAGG + Intronic
933041629 2:77474988-77475010 TCGTGAAGCAAGTTTAAAGTGGG + Intronic
933860740 2:86464733-86464755 TTCACTAGAAAGTTTAAAGTAGG + Intronic
934473292 2:94575036-94575058 TCAGGGAGCAAGTATAAAGTAGG - Intergenic
935072803 2:99710748-99710770 TCATTTAAGAAGTTAAAAGTGGG + Intronic
935617771 2:105103363-105103385 ACAGCCATCAAGTTTAAAGTAGG + Intergenic
937548131 2:123050401-123050423 TAATTTAGCAAGTTTTTAGTGGG + Intergenic
937771188 2:125722269-125722291 TAATTTAGCAACTTTTAAGTGGG + Intergenic
939400472 2:141685900-141685922 ACATGTAGCAAGTTTCCAGTTGG + Intronic
940955333 2:159720692-159720714 TCCTCTAGCAAGATTTATGTTGG + Intronic
941379345 2:164773984-164774006 TTATCAAGCAATTTTAAAATTGG + Intronic
941471955 2:165898764-165898786 TCATCTATAAAGATAAAAGTTGG + Exonic
942964934 2:181880702-181880724 TCATGTAGCCATTTTAAAGATGG + Intergenic
943291093 2:186072710-186072732 TCTTCTAGCAAGAGTATAGTTGG - Intergenic
943815906 2:192254295-192254317 TCATCTTGCCAGTAGAAAGTGGG + Intergenic
944268722 2:197757827-197757849 TCATTTACCAATTTTTAAGTTGG - Intronic
944323529 2:198376787-198376809 TTATCAAGCAAGTGCAAAGTGGG - Intronic
944523271 2:200592843-200592865 TTTTCTAGAAAGTTTAAAGCAGG - Intronic
1170556269 20:17517582-17517604 ACTTCTAGAAAGTTTAAAGTTGG - Intronic
1173053321 20:39586593-39586615 TCATTTACCTAGTTTAAATTAGG + Intergenic
1173536079 20:43814434-43814456 TCATCTATAAAGTAGAAAGTGGG + Intergenic
1173759147 20:45544706-45544728 ACATCTATCGAGTTTAAAATAGG - Intronic
1173984919 20:47253560-47253582 TCACCTGGCAAGTTTATTGTTGG - Intronic
949641024 3:6036151-6036173 GCAGCCAGGAAGTTTAAAGTGGG - Intergenic
953274902 3:41485259-41485281 TCATCTAGCAAGTTTAAAGTGGG + Intronic
953391792 3:42538174-42538196 TCCTCTAGCAAGTTTGCAGGAGG - Intergenic
953943361 3:47122741-47122763 TCATCTAGCTTTTTTAAAGTAGG + Exonic
955157483 3:56430853-56430875 TCATCTAGCATGTATGAAGTAGG + Intronic
963472560 3:145760428-145760450 TTTTCTAGCAATTTGAAAGTTGG + Intergenic
963713010 3:148768864-148768886 TCATCTATGAACTCTAAAGTAGG + Intergenic
964021494 3:152018598-152018620 ACATCTATCAACTTTATAGTAGG + Intergenic
965325515 3:167298921-167298943 TCATGAAGCAAATATAAAGTAGG + Intronic
967937088 3:194737788-194737810 TCAGCCAGCAAGTTCCAAGTTGG - Intergenic
970337119 4:15059809-15059831 CCATCTAACAAGTGCAAAGTGGG - Intronic
970943638 4:21664490-21664512 CCATCTTGCAATTTGAAAGTTGG + Intronic
971518391 4:27517102-27517124 TCATCTATCAAGTTAAAATTTGG - Intergenic
971572795 4:28234786-28234808 TCATCTTAGAATTTTAAAGTTGG + Intergenic
974615606 4:64275596-64275618 TCATCTAACAATTATAAATTTGG + Intronic
976062881 4:81150944-81150966 TTATGTAGCAATTTAAAAGTGGG - Intronic
976376868 4:84355389-84355411 TAATCTACCCATTTTAAAGTTGG - Intergenic
976531689 4:86161569-86161591 TCATCTGTCAAGTTTAATTTGGG + Intronic
978922570 4:114201869-114201891 TAATCTAACAACTTTTAAGTAGG + Intergenic
980666746 4:135949852-135949874 TCATCTAAAAAGATTAAAATTGG + Intergenic
981649094 4:147035970-147035992 TCTTCTAGTAACTTTAAAATGGG + Intergenic
983610480 4:169638978-169639000 CCAATTAGCAAGTATAAAGTTGG + Intronic
983778730 4:171642129-171642151 TAATTTAGGAAGTTTAAAGGTGG - Intergenic
984839273 4:184052957-184052979 TCATCTCTCAAATTTAAAGCTGG - Intergenic
987105711 5:14636918-14636940 TCATCTGTCAAGGTTCAAGTTGG + Intergenic
988330439 5:29831632-29831654 TGTTTTAGCAAGTTTAAATTAGG - Intergenic
990197452 5:53334587-53334609 GCACCTTGCAAGTTTAAACTGGG - Intergenic
993418745 5:87672495-87672517 ACATCTACTAAGTTGAAAGTTGG + Intergenic
998609620 5:143673847-143673869 TCATCTGTCAAGTTTCAGGTGGG + Intergenic
1001374390 5:171241872-171241894 TCATTTAGCGAGTCTGAAGTGGG + Intronic
1003736057 6:8878751-8878773 CTATGGAGCAAGTTTAAAGTTGG + Intergenic
1003810524 6:9774522-9774544 TCCTCTAGCAAGTGAAAAATGGG - Intronic
1005887106 6:30105683-30105705 ACATATAGCATGTTTAAATTTGG + Intronic
1007971139 6:46053423-46053445 TCATTTAGCAAGTGTTAACTGGG - Intronic
1010430585 6:75774104-75774126 TCATCAAGCAATTATTAAGTGGG - Intronic
1014703096 6:124713952-124713974 TCATCTAGCAACTTTAAAATTGG + Intronic
1015054838 6:128887920-128887942 TCATCTATCCAGTTTGCAGTAGG + Intronic
1017123701 6:151047392-151047414 TCAGGGAGCAAGTATAAAGTAGG + Intronic
1017352105 6:153454524-153454546 TCTTCTAGGAATTTTATAGTGGG + Intergenic
1018581568 6:165312544-165312566 TCACCGAGCATTTTTAAAGTAGG - Intergenic
1019754119 7:2756046-2756068 CTTTCTAGCAAGTTGAAAGTTGG - Intronic
1020547767 7:9555001-9555023 TCATCTAGCGATTTAAATGTGGG + Intergenic
1020892017 7:13889867-13889889 TCTTATAGAAAGTTTAATGTGGG - Intergenic
1020956173 7:14741818-14741840 TCATCTGGCATGGCTAAAGTTGG + Intronic
1023735233 7:43230041-43230063 ACATCAGGCAAATTTAAAGTGGG + Intronic
1027835843 7:83240808-83240830 GCATCCAACAAGTTTAAAGCAGG - Intergenic
1027897027 7:84058120-84058142 CCATCTAGCCAGTTTACAGATGG + Intronic
1031239923 7:119224300-119224322 TTGTCTAGCAAGTTTAAACGTGG + Intergenic
1036405960 8:8455543-8455565 TCATCTTTCAAGGTTAACGTAGG - Intergenic
1036984265 8:13509277-13509299 TCAGATAGCAAGTTGACAGTAGG + Intronic
1040790904 8:51229000-51229022 TCATCTAAAAAGTTTAAGATAGG - Intergenic
1041041749 8:53853605-53853627 TCATCTAGCAAATGTAAGGATGG + Intronic
1041299837 8:56399531-56399553 ACTTCTAGCAATTATAAAGTGGG - Intergenic
1042042616 8:64609066-64609088 CAATCTAGGAAGTTCAAAGTTGG + Intronic
1044113914 8:88310820-88310842 TCTACTAGCAAGTATAAATTTGG + Intronic
1045637066 8:104204066-104204088 TTATCTAGCATTTTTAATGTGGG - Intronic
1047376385 8:124301298-124301320 TCATGTGGCAACTTAAAAGTTGG + Intergenic
1047902827 8:129442578-129442600 ACATATAGCAAATTCAAAGTTGG + Intergenic
1050828316 9:9977958-9977980 TCATCTAGCACATGGAAAGTGGG + Intronic
1053685046 9:40513483-40513505 TCAGGGAGCAAGTATAAAGTAGG + Intergenic
1053935007 9:43141769-43141791 TCAGGGAGCAAGTATAAAGTAGG + Intergenic
1054278683 9:63111480-63111502 TCAGGGAGCAAGTATAAAGTAGG - Intergenic
1054298137 9:63348940-63348962 TCAGGGAGCAAGTATAAAGTAGG + Intergenic
1054396155 9:64653457-64653479 TCAGGGAGCAAGTATAAAGTAGG + Intergenic
1054430798 9:65158652-65158674 TCAGGGAGCAAGTATAAAGTAGG + Intergenic
1054499583 9:65862869-65862891 TCAGGGAGCAAGTATAAAGTAGG - Intergenic
1055685676 9:78771426-78771448 TCATCTGGCAGGTTTAAGGTGGG + Intergenic
1059127568 9:111707113-111707135 TTATCTGGCAACTTTAAAATGGG + Intronic
1059793889 9:117669786-117669808 TCATTTAGCACGTTTGCAGTAGG - Intergenic
1060533621 9:124365039-124365061 TGTTCTAGGAAGTTTAAAGATGG + Intronic
1191015403 X:55804669-55804691 GCATCTAGAAAGTGTAAAGTTGG - Intergenic
1191135925 X:57065115-57065137 TCATCTAGTTAGTTTGAAGATGG - Intergenic
1191671966 X:63756075-63756097 TCATACAGCAAGTTTGAGGTAGG - Intronic
1192736855 X:73857316-73857338 TTGTCTAGTAAGTTTAATGTTGG - Intergenic
1193225108 X:78973219-78973241 TAATCTACAAAGTTGAAAGTGGG - Intergenic
1194526290 X:94981498-94981520 ACATGTAGCAAGTTTAATGATGG - Intergenic
1198978130 X:142360706-142360728 TCATCTCCCATGTATAAAGTAGG - Intergenic
1199191356 X:144975119-144975141 TCATGTAGCAAGCTGAAATTTGG + Intergenic
1201498782 Y:14618773-14618795 TCATCTAGTGAGTTGAAACTGGG + Intronic