ID: 953275209

View in Genome Browser
Species Human (GRCh38)
Location 3:41489045-41489067
Sequence GTGGATAAACTGAGGGTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 569
Summary {0: 1, 1: 0, 2: 8, 3: 59, 4: 501}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953275209 Original CRISPR GTGGATAAACTGAGGGTCAG GGG (reversed) Intronic
900541018 1:3202810-3202832 GTGGGGAAACTGAGGCCCAGAGG - Intronic
900693067 1:3993401-3993423 GTGGGGAAACTGAGGCTGAGAGG + Intergenic
900708343 1:4094495-4094517 GTGGATACAGTGAAGGCCAGAGG - Intergenic
900778227 1:4600380-4600402 GCGGATCCACCGAGGGTCAGGGG + Intergenic
900893147 1:5464208-5464230 GTGGACAAGTTGAGGGTCACGGG + Intergenic
900901943 1:5523078-5523100 ATGGCTAAACGGAGGGTCAGAGG + Intergenic
901657360 1:10777115-10777137 GTGGGGAAACTGAGGCCCAGAGG - Intronic
901812758 1:11777125-11777147 CTAGAGAAACTGAGGCTCAGAGG + Intronic
902235383 1:15053993-15054015 ATGGGGAAACTGAGGCTCAGAGG + Intronic
902437178 1:16405880-16405902 ATGGGGAAACTGAGGCTCAGAGG - Intronic
902679628 1:18033868-18033890 ATGGACACACTGAGGCTCAGAGG - Intergenic
902744606 1:18465104-18465126 GTGGGAAAAATGAGGCTCAGAGG - Intergenic
902759896 1:18574375-18574397 ATGGGTAAACTGAGGCCCAGAGG - Intergenic
902923703 1:19682107-19682129 TTGGGGAAACTGAGGCTCAGAGG - Intergenic
903182116 1:21610025-21610047 CTGGAAAAAGTGAGGCTCAGAGG + Intronic
903278873 1:22238826-22238848 ATGTGTAAACTGAGGCTCAGAGG + Intergenic
903300939 1:22378388-22378410 ATGGGGAAACTGAGGTTCAGAGG + Intergenic
903384524 1:22917659-22917681 GGGGGGAAACTGAGGCTCAGGGG + Intergenic
903419311 1:23207005-23207027 TTGGAGAAACTGAGGCTCGGAGG - Intergenic
904046333 1:27611266-27611288 GTGAGAAAACTGAGGCTCAGGGG - Intergenic
904267801 1:29327588-29327610 ATGGAGAAACTGAGGCACAGAGG - Intergenic
904296163 1:29521108-29521130 ATGGAGAAACTGAGGCTCTGAGG - Intergenic
904422984 1:30405945-30405967 ATGGGGAAACTGAGGTTCAGAGG + Intergenic
905770275 1:40633286-40633308 GAGGAGAAACTGAGGCACAGAGG - Intronic
906079122 1:43071968-43071990 GTGGAGAAACTGAGGCTCAGAGG + Intergenic
906145227 1:43556681-43556703 ATGGAGCAAATGAGGGTCAGAGG - Intronic
906494338 1:46293327-46293349 GAGGATCAATTGAGCGTCAGGGG - Intronic
907113977 1:51952413-51952435 GTGGATTAGCTGAAGGTCATAGG + Intronic
907455853 1:54575073-54575095 GTGGAGAAACTGAGCCCCAGGGG - Intronic
907824751 1:58004597-58004619 ATGGAGAAACTGAGGCTCAGAGG - Intronic
908475836 1:64487257-64487279 GAGGATAAACTGACAGCCAGGGG - Intronic
908969687 1:69812350-69812372 ATGAAGAAACTGAGGCTCAGAGG - Intronic
911296817 1:96127899-96127921 ATGGAGAAACTGAGGTTCACAGG + Intergenic
912511259 1:110191798-110191820 TTGGGGAAACTGAGGCTCAGAGG + Intronic
912708248 1:111930736-111930758 GAGGAGAAACTGAGACTCAGAGG - Intronic
913091714 1:115480611-115480633 GTGGGGAAACTGAGGCTCAGAGG - Intergenic
914448251 1:147768784-147768806 ATGAAAAAACTGAGGCTCAGAGG + Intronic
915852655 1:159342731-159342753 GTGGAGAATTTGAGGCTCAGTGG - Intergenic
915901706 1:159851442-159851464 ATGAATAAACTGAGGCTCAGAGG - Intronic
916196078 1:162224690-162224712 CTGGATAAAATCAGGCTCAGGGG - Intronic
917713828 1:177713354-177713376 ATGGGGAAACTGAGGATCAGGGG - Intergenic
919024451 1:192149629-192149651 TTGGATAAAATGAGGCCCAGTGG + Intergenic
919826062 1:201504243-201504265 ATGGAGAAACTGAGGCTCAGAGG - Intronic
919974425 1:202601533-202601555 GTGGGTGAACTGAGGCACAGAGG + Intronic
920011368 1:202870155-202870177 TTGGATAAATTGAGGTTCAGAGG - Intergenic
920255304 1:204650453-204650475 AGGGAGAGACTGAGGGTCAGGGG + Intronic
922407608 1:225332344-225332366 GTGTATAGACTGAGAGGCAGTGG + Intronic
922478985 1:225925421-225925443 GTGCACAAACTGAGGGCCTGGGG - Intergenic
924155580 1:241173117-241173139 GTGCATAAACTGAGGCCCATAGG + Intronic
1062937401 10:1398726-1398748 CTGGGTAATTTGAGGGTCAGAGG - Intronic
1063625421 10:7685218-7685240 GAGCATAAACTGAGGAACAGAGG - Intergenic
1065858032 10:29846361-29846383 TGGGAAAAACTGAGGCTCAGAGG - Intergenic
1066629406 10:37444332-37444354 ATGAAGAAACTGAGGCTCAGAGG + Intergenic
1067081201 10:43213418-43213440 GTGGCTAGACTGAGGGTCCAGGG + Intronic
1067288609 10:44925247-44925269 TTAGACAAACAGAGGGTCAGCGG - Intronic
1067455193 10:46414228-46414250 GTGGGTGAGCTGAGGGTAAGGGG - Intergenic
1067632007 10:47970406-47970428 GTGGGTGAGCTGAGGGTAAGGGG + Intergenic
1067894408 10:50163489-50163511 GTGGAGAAACTGAGCCACAGAGG + Intergenic
1069734715 10:70646375-70646397 ATGGAGAAACTGAGGCTCAGAGG + Intergenic
1069804733 10:71113225-71113247 GTGTAGAAACTGTGAGTCAGGGG + Intergenic
1070313237 10:75288666-75288688 GTGGAACAACTCAGGGTAAGGGG + Intergenic
1071565027 10:86667344-86667366 TTGGAGAAACTGAGGCTCAGGGG - Intergenic
1071651431 10:87396470-87396492 GTGATGAAACTGAGGCTCAGGGG - Intergenic
1072250204 10:93575888-93575910 ATGGCTATTCTGAGGGTCAGGGG + Intronic
1072633987 10:97165662-97165684 GAGGAGAAACCGAGGGCCAGCGG + Intronic
1073964541 10:108973658-108973680 GTGAATCAACTGAGGCTGAGAGG + Intergenic
1074118483 10:110475813-110475835 ATAGGTAAACTGAGGCTCAGAGG - Intergenic
1074568895 10:114606779-114606801 ATAGACAAACTGAGGCTCAGAGG + Intronic
1074993850 10:118738279-118738301 GTGGAGAAACTGAGAGACAAAGG + Intronic
1075078927 10:119369902-119369924 CTGGGTAAACGGAGGGTCAGGGG - Intronic
1075104280 10:119527634-119527656 GGGGGTAAACTGAGGCTCGGAGG + Intronic
1075256524 10:120929967-120929989 GTGAGTAAACTGAGGCACAGAGG - Intergenic
1075599055 10:123753803-123753825 TTGGATAATCTGAGGGTCAGAGG - Intronic
1077143399 11:1034678-1034700 GTGGAGAAACTGAGTTGCAGGGG - Intronic
1077184318 11:1229508-1229530 GTGGGGAAACTGAGGCCCAGAGG + Intronic
1077317584 11:1926228-1926250 GTGGGGAAACTGAGGCTCAGAGG - Intronic
1077322461 11:1948383-1948405 GAGGAGGAAGTGAGGGTCAGAGG + Intronic
1077322732 11:1949561-1949583 GAGGAGGAAGTGAGGGTCAGAGG - Intronic
1077367672 11:2167681-2167703 GTGGGGAAACTGAGGCCCAGGGG - Intronic
1077523089 11:3047832-3047854 GTGGAAGAGCTGGGGGTCAGCGG + Exonic
1078762365 11:14261460-14261482 ATGGAGAAACTGAGGAACAGAGG - Intronic
1079444110 11:20544356-20544378 GATGAGAAACTGAGGCTCAGAGG + Intergenic
1079832882 11:25292240-25292262 GTGTAGAAACTAAGAGTCAGGGG + Intergenic
1080052903 11:27874865-27874887 ATGAAGAAACTGAGGCTCAGAGG + Intergenic
1080643550 11:34172672-34172694 ATGAAGAAGCTGAGGGTCAGAGG - Intronic
1080746715 11:35114970-35114992 ATGAGTAAACTGAGGCTCAGGGG + Intergenic
1080774471 11:35372918-35372940 GTGGGGAAACTGAGGCACAGAGG + Intronic
1081219618 11:40444191-40444213 GTGGGAAAACTGAGGATCAGAGG + Intronic
1081453066 11:43192110-43192132 GCAGATAAGCTGAGGGCCAGAGG - Intergenic
1081758413 11:45560556-45560578 GTGGGGAAAGTGAGGTTCAGGGG + Intergenic
1081840494 11:46197645-46197667 GTGAATGAACTGAGCCTCAGAGG + Intergenic
1083215962 11:61220116-61220138 GTGGATAAGTTCAGGGACAGTGG - Intergenic
1083218846 11:61238942-61238964 GTGGATAAGTTCAGGGACAGTGG - Intergenic
1083333374 11:61909393-61909415 AGGGAGAAACTGAGGCTCAGGGG - Intronic
1083601249 11:63949608-63949630 GGGGATAAACTGGGGCTCTGGGG + Intronic
1083628303 11:64083071-64083093 GTGAGGAAACTGAGGCTCAGGGG + Intronic
1083639544 11:64138086-64138108 GTGAGGAAACTGAGGTTCAGGGG + Intronic
1084219975 11:67671840-67671862 GTGAATAAAATGAGAGGCAGGGG - Intronic
1084264807 11:67999398-67999420 GTGGGGAAACTGAGGCCCAGAGG + Intronic
1084270688 11:68027642-68027664 ATGGGGAAACTGAGGCTCAGAGG + Intronic
1084561168 11:69906221-69906243 GTGAGGAAACTGAGGCTCAGAGG - Intergenic
1084708919 11:70831932-70831954 ATGGGGAAACTGAGGGTCAGGGG - Intronic
1085317448 11:75554207-75554229 ATGGGGAAACTGAGGCTCAGAGG + Intergenic
1085361978 11:75897421-75897443 ATGGAAAAACTGACGTTCAGGGG + Intronic
1085414518 11:76311279-76311301 GTGGGGAAACTGAGGCTCACAGG - Intergenic
1087013344 11:93533597-93533619 TTAGATAGACTGAGGGTTAGGGG - Intronic
1088491418 11:110392033-110392055 GATGAAAAACTGAGGTTCAGGGG - Intergenic
1088669079 11:112123663-112123685 TTGGATAAAATGAGGGGGAGAGG - Intronic
1089069975 11:115692354-115692376 ATGGGGAAACTGAGGCTCAGAGG - Intergenic
1089112398 11:116067183-116067205 GTGACAAAACTGAGGCTCAGAGG - Intergenic
1089315370 11:117587639-117587661 GATGATAAACTGAGGAGCAGGGG + Intronic
1089655126 11:119941664-119941686 GTAATTAAACTGAGGATCAGAGG + Intergenic
1089698623 11:120230873-120230895 TTGGTTGAGCTGAGGGTCAGCGG + Intergenic
1089921565 11:122213787-122213809 GTGGGGAAACTGAGGCTGAGGGG - Intergenic
1090087650 11:123664892-123664914 CTGAAGAAACTGAGGCTCAGAGG - Intergenic
1090267180 11:125360483-125360505 ATGGGGAAACTGAGGCTCAGAGG + Intronic
1090415742 11:126539117-126539139 ATGGGGAAACTGAGGCTCAGAGG - Intronic
1090699987 11:129285382-129285404 CTGGATATACTGAGGGCTAGGGG + Intergenic
1090826903 11:130393914-130393936 ATGAAGAAACTGAGGCTCAGAGG + Intergenic
1091028864 11:132165619-132165641 GTGAGGAAACTGAGGCTCAGGGG + Intronic
1202805479 11_KI270721v1_random:3696-3718 GAGGAGGAAGTGAGGGTCAGAGG + Intergenic
1202805750 11_KI270721v1_random:4874-4896 GAGGAGGAAGTGAGGGTCAGAGG - Intergenic
1091771895 12:3157491-3157513 ATGGAGAAACTGAGATTCAGAGG - Intronic
1093222367 12:16437921-16437943 GTGGATAATCTGAGACTTAGAGG - Intronic
1094204054 12:27821929-27821951 GTAAAGAAACTGAGGCTCAGAGG - Intergenic
1094425803 12:30315993-30316015 ATGAAGAAACTGAGGCTCAGAGG - Intergenic
1095186517 12:39207308-39207330 ATGGATACACTGACGGTTAGTGG + Intergenic
1095359091 12:41313929-41313951 GTGTATAAACTGAGAGTAATGGG + Intronic
1095840454 12:46686012-46686034 ATAGAGAAACTGAGGCTCAGAGG + Intergenic
1096256679 12:50066245-50066267 ATGGGAAAACTGAGGCTCAGAGG + Intronic
1096470367 12:51871794-51871816 ATGAAGAAACTGAGGCTCAGAGG - Intergenic
1096549623 12:52363625-52363647 GTGGGAAAACTGAGGCCCAGAGG + Intronic
1098659716 12:73076489-73076511 GAGGATATGCTGAGGGACAGAGG - Intergenic
1098763487 12:74454419-74454441 GAGGAAAAACTCAGGGTCAGGGG + Intergenic
1099243843 12:80171049-80171071 GTGTATAAACTGTGAGTCATAGG + Intergenic
1101095644 12:101337096-101337118 GTGATGAAACTGAGGCTCAGAGG - Intronic
1101535330 12:105611351-105611373 ATGGAGAAACTGAGGCTGAGAGG - Intergenic
1101616031 12:106338221-106338243 GTGGGTAAATTGAGGGTCACTGG + Intronic
1101965170 12:109277446-109277468 ATGAAGAAACTGAGGCTCAGGGG - Intergenic
1101966865 12:109287755-109287777 GTGAGTAAACTGAGGCTCAGAGG + Intronic
1102024067 12:109703539-109703561 ATGGGGAAACTGAGGCTCAGAGG + Intergenic
1102219219 12:111183043-111183065 ATGCAGAAACTGAGGCTCAGAGG + Intronic
1102440747 12:112962488-112962510 GTGGGTAAACTGAGGTTCAGAGG - Intronic
1102649732 12:114431099-114431121 GTGGGTAAACTGAGGCTCAAAGG + Intergenic
1102775339 12:115513888-115513910 TTGGATAATCTGGGGGTCTGGGG - Intergenic
1103006071 12:117421325-117421347 GTGTAGAAAGTGAGGCTCAGAGG - Intronic
1103054149 12:117805427-117805449 ATGAAGAAACTGAGGCTCAGAGG - Intronic
1103159186 12:118713387-118713409 ATGGGTAAACTGAGGCTCAGAGG + Intergenic
1103568336 12:121828248-121828270 GATGAGAAACTGAGGCTCAGAGG - Intronic
1103917196 12:124382014-124382036 GTGGGGAAGCAGAGGGTCAGTGG - Intronic
1103938312 12:124488404-124488426 GAGGAGAAACTGAGGCTCAGAGG - Intronic
1104485333 12:129146891-129146913 GAGGGGAAACTGAGGCTCAGAGG + Intronic
1104998565 12:132674336-132674358 GTGGATGAACTGAAGGCAAGAGG - Intronic
1105213291 13:18270567-18270589 GTGGGGAAACTGAGTCTCAGAGG + Intergenic
1105280288 13:18959257-18959279 GTGGACAAACTGAGAACCAGAGG + Intergenic
1106624770 13:31409291-31409313 GTGGATGAGCAGAGGGCCAGGGG + Intergenic
1106743260 13:32670812-32670834 GTGCAAAAACAGAGGCTCAGTGG - Intronic
1106794947 13:33195826-33195848 ATGAAAAAACTGAGGCTCAGAGG - Intronic
1107435481 13:40377305-40377327 GAGGATTAACTGAGGGGAAGAGG - Intergenic
1107992147 13:45828082-45828104 GTGAGAAAACTGAGGTTCAGAGG - Intronic
1108078798 13:46710950-46710972 GTGAAGAAATTGAGGGACAGTGG - Intronic
1108462278 13:50678540-50678562 ATGAAAAAACTGAGGTTCAGGGG + Intronic
1108465318 13:50709100-50709122 ATGGAGAATCTGAGGCTCAGAGG + Intronic
1108519051 13:51229083-51229105 TTGCATATACTGAGGATCAGAGG + Intronic
1108746639 13:53402132-53402154 TTTGATCAACTTAGGGTCAGAGG - Intergenic
1112184291 13:97113250-97113272 GTGGGGAAACTGAGGCTCACAGG - Intergenic
1117589449 14:57251408-57251430 CTGGATAAAGTGACTGTCAGAGG + Intronic
1119399336 14:74351573-74351595 GTGGATAACCTGAGCCTCAGGGG - Intronic
1119441619 14:74632151-74632173 GTGGATAAACTGAGGCCCCAAGG - Intergenic
1119444881 14:74654821-74654843 GTGGAAACACTGAGCTTCAGTGG - Intronic
1120144240 14:80962090-80962112 ATGGAGAAACTGAGGCCCAGAGG - Intronic
1120550112 14:85859939-85859961 GTGGATAAAGTGATGTTCTGTGG + Intergenic
1120890788 14:89489184-89489206 GATGAAAAACTGAGGTTCAGGGG - Intronic
1121419287 14:93801194-93801216 ATGGAGAAACTGAGGTCCAGGGG - Intergenic
1121661189 14:95636350-95636372 ATGAAGAAACTGAGGGTCAGAGG - Intergenic
1122114427 14:99520628-99520650 GGTGATAAACTGAGGTTCAGGGG - Intronic
1122150941 14:99725937-99725959 ATGGAGAAACTGAGGCTCAGAGG - Intronic
1122566177 14:102658197-102658219 GTAGATCATCTGAGGTTCAGAGG - Intronic
1122804560 14:104250002-104250024 ATGGGGAAACTGAGGCTCAGAGG + Intergenic
1124395067 15:29293927-29293949 GTGGGGAAACTGAGGGTGGGGGG + Intronic
1126832205 15:52619605-52619627 GTGGATCAACTTGAGGTCAGGGG + Intronic
1127272890 15:57417030-57417052 GTGAAGCAACTGAGGCTCAGTGG - Intronic
1128069073 15:64782604-64782626 TTGGGGAAACTGAGGTTCAGCGG + Intergenic
1128129416 15:65215683-65215705 GAGGATGAACTGAGGCTAAGAGG + Intergenic
1128327075 15:66730788-66730810 ATGAAAAAACTGAGGCTCAGAGG + Intronic
1128683948 15:69670184-69670206 GTGAGGAAACTGAGGTTCAGAGG + Intergenic
1129738591 15:77979025-77979047 ATGGAGACACTGAGGCTCAGAGG + Intergenic
1129940581 15:79493670-79493692 ATGAGTAAACTGAGGTTCAGTGG - Intergenic
1130512581 15:84601427-84601449 ATGGGGAAACTGAGGTTCAGAGG + Intronic
1130745169 15:86645491-86645513 ATGTAGAAACTGAGGCTCAGTGG + Intronic
1130923364 15:88367209-88367231 ATGGGGAAACTGAGGCTCAGGGG + Intergenic
1131650974 15:94399427-94399449 GGGAATAAACTGAGGGTCAGAGG - Intronic
1131884687 15:96899234-96899256 ATGTAAAAACTGAGGCTCAGTGG - Intergenic
1132386193 15:101401774-101401796 ATGGGAAAACTGAGGCTCAGTGG - Intronic
1132678535 16:1130558-1130580 ATGGATAAACTGGGGGTCAAAGG - Intergenic
1132862469 16:2078372-2078394 GTGGATGGACTGAGGGCCATGGG - Intronic
1132956295 16:2595836-2595858 GTGGATAAGCGGAAGGTGAGTGG + Exonic
1133038979 16:3049906-3049928 ATGGGAAAACTGAGGCTCAGAGG - Intronic
1133222637 16:4325332-4325354 ATGCAAAAACTGAGGCTCAGGGG - Intronic
1134094682 16:11411621-11411643 ATGGGGAAACTGAGGCTCAGGGG - Intronic
1134132582 16:11659522-11659544 ATGGAGAAACTCAGGCTCAGCGG + Intergenic
1134349205 16:13420768-13420790 GTGCACATGCTGAGGGTCAGGGG - Intergenic
1134378182 16:13699135-13699157 TTGGATAAATTGAGGGGCAGCGG + Intergenic
1135044009 16:19139907-19139929 GTGAATAAACTGAGGTTCAGAGG - Intronic
1135157117 16:20061950-20061972 ATGGAAAAACTGAGGCTTAGAGG - Intronic
1135574654 16:23576022-23576044 GTGGCTGAAGTGAGGGTCACAGG - Intergenic
1136230213 16:28881236-28881258 ATGAAGAAACTGAGGCTCAGAGG - Intronic
1137568141 16:49546944-49546966 GTGAGAAAACTGAGGCTCAGAGG - Intronic
1137767929 16:50992053-50992075 ATGGAGAAACTGAGGCTCAAGGG + Intergenic
1137798869 16:51244425-51244447 GTGGCAAAATTGAGGTTCAGAGG - Intergenic
1138454577 16:57113968-57113990 GTGGGGAAACTGAGGCCCAGAGG - Intronic
1138477590 16:57281278-57281300 GTGAGAAAACTGAGGCTCAGAGG - Intronic
1138990807 16:62388721-62388743 ATGAAGAAACTGAGGTTCAGTGG - Intergenic
1139360744 16:66398242-66398264 ATGGAGAAACTGAGGCTCAGAGG + Intronic
1140151772 16:72374709-72374731 GTAGATAAAGTGAGGCTCACAGG + Intergenic
1140272997 16:73483119-73483141 GTGGATCAGCTTAGGGTCTGGGG + Intergenic
1141335286 16:83148524-83148546 GTGCATAAAATGAGGCACAGAGG - Intronic
1141750923 16:85957365-85957387 CTGGGGAAACTGAGGCTCAGAGG + Intergenic
1142279470 16:89140226-89140248 GAGGACAGACTGAGGCTCAGAGG - Intronic
1144699267 17:17326235-17326257 ATGAAGAAACTGAGGCTCAGAGG + Intronic
1144774395 17:17777746-17777768 GTGGGGAAACTGAGGCCCAGAGG + Intronic
1146289998 17:31600001-31600023 ATGGGTAAACTGAGGCCCAGAGG + Intergenic
1146552596 17:33794473-33794495 ATGGATGAATTGTGGGTCAGGGG + Intronic
1146826734 17:36029614-36029636 GTGGATGAACAGATGGACAGAGG - Intergenic
1147166851 17:38598108-38598130 GTGGACAAAGTGAGAGTCTGCGG + Intronic
1148126197 17:45238385-45238407 GTGGAAAAAGTGAGGGAGAGTGG + Intronic
1148395774 17:47307045-47307067 GTAGATAAACTGTGAGTCATGGG + Intronic
1148987938 17:51639835-51639857 ATGTAGAAACTGAGGCTCAGAGG - Intronic
1149021983 17:51978967-51978989 GTGGCTTTACTGAGGGTCATGGG - Intronic
1149033965 17:52114420-52114442 CTGGGCAAACTGAGGCTCAGTGG - Intronic
1149438502 17:56654580-56654602 GATGAGAAACTGAGGCTCAGAGG - Intergenic
1150997743 17:70338599-70338621 ATGGAGAAACTGAAGATCAGTGG - Intergenic
1151253998 17:72860881-72860903 GTGCATAAACTGAGGCGCAGAGG - Intronic
1151930643 17:77229663-77229685 ATGGGGAAACTGAGGCTCAGAGG + Intergenic
1152236868 17:79143437-79143459 GTGGAGGAAAAGAGGGTCAGAGG - Intronic
1152365700 17:79855155-79855177 ATGGAGAAACTGAGGCACAGGGG - Intergenic
1152573979 17:81132229-81132251 GTGGGGAAGCTGAGGCTCAGAGG + Intronic
1152741930 17:82022265-82022287 GTGGAGAAACTGAGGCACGGGGG - Intronic
1152794570 17:82300873-82300895 GTGGGGAAACTGAGGCCCAGAGG - Intergenic
1153778946 18:8477746-8477768 GTGGGACAACTGAGGCTCAGAGG + Intergenic
1155898237 18:31355249-31355271 TTGGTTAAAGTGATGGTCAGAGG - Exonic
1156610853 18:38722521-38722543 ATGGATAGACTGATGGACAGAGG - Intergenic
1157122476 18:44924533-44924555 ATGGGGAAACTGAGGTTCAGAGG + Intronic
1157310057 18:46546075-46546097 GGGGATACTTTGAGGGTCAGAGG + Intronic
1158298617 18:56027595-56027617 GTGGAGAAATTGGGGGTCGGTGG - Intergenic
1158882789 18:61797169-61797191 ATGAAGAAACTGAGGTTCAGAGG + Intergenic
1160920751 19:1519136-1519158 GTGGATTACCTGAGGTTGAGAGG + Intergenic
1160990711 19:1859243-1859265 GTGGGGAAACTGAGGCCCAGAGG - Intronic
1161076097 19:2286518-2286540 GTGGGGAAACTGAGGCACAGTGG - Intronic
1161115924 19:2496283-2496305 GAGGGTAAACTGAGGCACAGAGG + Intergenic
1161342673 19:3751614-3751636 GAGGGTAAACTGAGGCCCAGAGG - Intronic
1161348331 19:3778816-3778838 CTGGAGAAACTGAGGCCCAGAGG + Intronic
1161514816 19:4690432-4690454 GTGAAGAAACTGAGGATAAGTGG + Intronic
1161760125 19:6164968-6164990 GTGAAGAAGCTGAGGCTCAGGGG - Intronic
1162514033 19:11137726-11137748 GTGGGGAAACTGAGGCTCTGAGG - Intronic
1162533741 19:11251176-11251198 ATGGGGAAATTGAGGGTCAGGGG + Intronic
1162534377 19:11254165-11254187 AAGGGTAAACTGAGGCTCAGAGG - Intronic
1162768439 19:12934328-12934350 GTGAGAAAACTGAGGCTCAGAGG + Intergenic
1162830723 19:13282644-13282666 ATGGGAAAACTGAGGCTCAGGGG - Intronic
1162894909 19:13759376-13759398 ATGGGGAAACTGAGGCTCAGAGG - Intronic
1163328455 19:16620332-16620354 GTGAGGAAACTGAGGCTCAGCGG - Intronic
1163432098 19:17274322-17274344 ATGGGGAAACTGAGGCTCAGAGG - Intronic
1163581380 19:18141240-18141262 ATGGAAAAACTGAGGCTCAGGGG - Intronic
1163827753 19:19533104-19533126 GTGGGGAAACTGAAGCTCAGAGG + Intronic
1164792675 19:31001588-31001610 AGGGATAAACTGAGGCTCAGAGG - Intergenic
1165708529 19:37993178-37993200 ATGAAGAAACTGAGGGGCAGGGG - Intronic
1166517034 19:43454774-43454796 ATGGGGAAACTGAGGCTCAGAGG + Intergenic
1166568417 19:43779097-43779119 ATGGGGAAACTGAGGTTCAGAGG + Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1166887319 19:45969990-45970012 ATGGGGAAACTGAGGCTCAGAGG - Intronic
1167505968 19:49871240-49871262 GTGGAGAAACTGAGGCTTGGAGG - Intronic
1167803738 19:51764281-51764303 GCAGGTAGACTGAGGGTCAGGGG + Intronic
1168120139 19:54247468-54247490 ATGCACAAACTGAGGCTCAGAGG + Intronic
1168583789 19:57576737-57576759 GTGGATAAGTTGAGGGGCACAGG - Intronic
926321011 2:11748423-11748445 ATGGGAAAACTGAGGCTCAGAGG - Intronic
926692270 2:15745753-15745775 ATGGAGAAACTGAGGCACAGAGG + Intergenic
926806363 2:16715643-16715665 GTAGAGAAACTGAGGCTCTGAGG + Intergenic
927170552 2:20365946-20365968 GTGGCTCAAGTGAGGGTGAGAGG - Intergenic
927427360 2:22995951-22995973 ATGGGTAAACTGAGGCCCAGAGG + Intergenic
927512512 2:23653206-23653228 GTGGGGAAACTGAGGCTCAGAGG + Intronic
929414911 2:41737436-41737458 GTGGAGAGTCTGAGGGTTAGGGG - Intergenic
930223287 2:48767307-48767329 CTGGATACACTGGGAGTCAGGGG + Intronic
931024155 2:58089899-58089921 GATGAGAAACTGAGAGTCAGAGG + Intronic
932033489 2:68215225-68215247 ATGGATAAACTGTGTGTCACGGG - Intronic
932316127 2:70784493-70784515 ATGGAGAAACTGAGGATTAGAGG + Intronic
933113372 2:78433148-78433170 GTGGTAAAACAGAGGGGCAGGGG + Intergenic
933276928 2:80293909-80293931 GTGGAGACACAGAGGGGCAGTGG + Intronic
933290336 2:80431388-80431410 ATGCAAAATCTGAGGGTCAGAGG - Intronic
933671744 2:85014452-85014474 ATGGATAAACTGAGGCACACAGG - Intronic
933757668 2:85652836-85652858 ATGGATAAACTGGGGGTAGGAGG - Intergenic
934301033 2:91776177-91776199 GTGGGAAAACTGAGTCTCAGAGG - Intergenic
934507774 2:94907760-94907782 GTGGGTAAAATGTGTGTCAGTGG - Intergenic
935086541 2:99851539-99851561 GTGGCAAAATTGAGGCTCAGAGG + Intronic
935285552 2:101561093-101561115 GTGGTTAAACTGTTAGTCAGTGG - Intergenic
936991766 2:118374228-118374250 ATGAAAAAACTGAGGTTCAGAGG - Intergenic
937441514 2:121919746-121919768 GGGCATCAACTGTGGGTCAGAGG + Intergenic
938584705 2:132678883-132678905 GTAAAGAAACTAAGGGTCAGAGG - Intronic
938609088 2:132928183-132928205 GTGGAGATACTGAGGCACAGAGG - Intronic
939722392 2:145670082-145670104 GTTGACAAACCGAGGCTCAGTGG + Intergenic
940032719 2:149281407-149281429 GTCGATGAACTGATGGTCATGGG - Intergenic
940457336 2:153917032-153917054 CTGAATAAACTGAGGCCCAGAGG - Intronic
941849782 2:170168184-170168206 GTGACAAAACTGAGGCTCAGGGG + Intergenic
942151381 2:173078941-173078963 GTGAGAAAACTGAGGATCAGGGG - Intronic
942537442 2:176979754-176979776 GTGAATAGACTAAGGCTCAGAGG - Intergenic
944441001 2:199743211-199743233 ATGGGGAAACTGAGGCTCAGTGG + Intergenic
944691340 2:202161103-202161125 TTGAAGAAACTGAGGCTCAGGGG + Intronic
944936717 2:204577365-204577387 GTGGGTAAACTGAGTCTTAGAGG + Intronic
948131827 2:235606721-235606743 GCAGATCACCTGAGGGTCAGGGG + Intronic
1168835646 20:875565-875587 ATGAAGAAACTGAGGCTCAGTGG - Intronic
1169013624 20:2273209-2273231 GTGAAGAAACTGAGTCTCAGAGG - Intergenic
1171977879 20:31606897-31606919 GTGGATAAAGTGAGACCCAGTGG + Intergenic
1172008938 20:31835310-31835332 ATGAAGAAACTGAGGCTCAGAGG + Intergenic
1172313272 20:33934110-33934132 GTGGATAACCTGAGGTCGAGAGG + Intergenic
1172870361 20:38131917-38131939 ATGAATAAACTGAGGCACAGAGG + Intronic
1173338712 20:42135214-42135236 CTGGGTAAACAGAGGCTCAGGGG - Intronic
1173800997 20:45894508-45894530 GTAGGGAAACTGAGGCTCAGTGG - Intronic
1173907659 20:46640630-46640652 ATGAATAAATTGAGGCTCAGGGG + Intronic
1173957941 20:47049037-47049059 ATGGAGAAACTGAGGCACAGAGG + Intronic
1173964358 20:47100559-47100581 AAGGAGAAACTGAGGCTCAGAGG + Intronic
1174171718 20:48621746-48621768 ATGAAAAAACTGAGGCTCAGAGG + Intergenic
1174347020 20:49937506-49937528 GTGAATACACTGAGGGTCCGAGG + Intronic
1174404223 20:50293278-50293300 CTGGAGAAACTGAGGCACAGAGG + Intergenic
1174602610 20:51737030-51737052 GTGGATAAAGTGAGCCCCAGAGG + Intronic
1174780275 20:53383034-53383056 GTGGATCACCTGAGGTTCGGAGG + Intronic
1175252013 20:57615519-57615541 TTGGCTGAACTGAGGGCCAGGGG + Exonic
1176423830 21:6535599-6535621 TTGGGGAAACTGAGGCTCAGAGG + Intergenic
1177161674 21:17554499-17554521 GGGGATAAACTGGGGATGAGAGG + Intronic
1178426676 21:32484316-32484338 GTGGATCACCTTAGGGTCAAGGG + Intronic
1178499117 21:33111015-33111037 GTGGGTAAACTGAGGTACGGGGG + Intergenic
1178499516 21:33114255-33114277 ATGGATAAACTGAGGCACAGTGG - Intergenic
1179313668 21:40221007-40221029 ATGCAGAAACTGAGGCTCAGAGG + Intronic
1179699323 21:43143914-43143936 TTGGGGAAACTGAGGCTCAGAGG + Intergenic
1180816117 22:18790967-18790989 GTGGGGAAACTGAGTCTCAGAGG + Intergenic
1181001126 22:19988228-19988250 GTGGGGGAACTGAGGCTCAGAGG - Intronic
1181202304 22:21225299-21225321 GTGGGGAAACTGAGTCTCAGAGG + Intronic
1181472804 22:23151301-23151323 GTGGGGAAACTGAGGATCAGAGG + Intronic
1181555662 22:23670445-23670467 GTGGGGAAACTGAGTCTCAGAGG + Intergenic
1181628253 22:24135743-24135765 ATGGAGAAACTGAAGGGCAGAGG + Intronic
1181787253 22:25236141-25236163 GTAGGGAAACTGAGGCTCAGAGG + Intergenic
1181814844 22:25430111-25430133 GTGAAGAAAATGAGGGGCAGGGG + Intergenic
1181860536 22:25814530-25814552 ATGAAGAAACTGAGGCTCAGAGG + Intronic
1181959275 22:26611226-26611248 ATGGAAAGACTGAGGCTCAGAGG - Intronic
1182051186 22:27314046-27314068 ATGGGTAAACTGAGGCTCAGAGG - Intergenic
1182463988 22:30503161-30503183 ATGAAGAAACTGAGGCTCAGTGG + Intronic
1183303131 22:37068314-37068336 ATGGGGAAACTGAGGCTCAGAGG - Intronic
1183482818 22:38074493-38074515 GTGGGAAAACTGAGGCCCAGAGG + Intronic
1183515848 22:38265537-38265559 ATGGAGAGACTGAGGCTCAGAGG - Intronic
1184263095 22:43330638-43330660 ATGGGCAAACTGAGGCTCAGGGG + Intronic
1184583217 22:45430785-45430807 ATGGGGAAACTGAGGCTCAGAGG - Intronic
1184689532 22:46111143-46111165 GTGGAGAAACTGAGGCTCAGGGG - Intronic
1185075485 22:48679960-48679982 GTGGGAAAACTGAGGTTCATGGG - Intronic
1185087047 22:48746590-48746612 ATGGAGAAACTGAGGCACAGGGG + Intronic
1203224606 22_KI270731v1_random:70114-70136 GTGGGGAAACTGAGTCTCAGAGG - Intergenic
1203266220 22_KI270734v1_random:16678-16700 GTGGGGAAACTGAGTCTCAGAGG + Intergenic
949144538 3:681578-681600 GTGCCTAAGCTTAGGGTCAGTGG - Intergenic
949840361 3:8313375-8313397 ATGGGTAAACTGAGGCTCAGAGG - Intergenic
950454055 3:13082321-13082343 GGGGATAAAAAGAGAGTCAGGGG - Intergenic
950660668 3:14465007-14465029 GTGGAGAAACTGAGGCTTGGTGG - Intronic
951742402 3:25939042-25939064 GTGGACAAGCAGAGGGTGAGAGG + Intergenic
952430376 3:33218321-33218343 GTTGAGAAACTGAGGGACGGCGG + Intronic
952556909 3:34542087-34542109 ATGGAGAAACTGAGGTTCTGAGG + Intergenic
952742156 3:36744544-36744566 GTGGTGAAACTGAGGTTCATAGG - Intergenic
952970509 3:38647992-38648014 GTGGGGAAACTGAGGCCCAGAGG - Intronic
953071703 3:39526998-39527020 GTGGATCACCTGAGGTCCAGAGG - Intronic
953275209 3:41489045-41489067 GTGGATAAACTGAGGGTCAGGGG - Intronic
953909607 3:46884984-46885006 ATGGGGAAACTGAGGTTCAGAGG + Intronic
954614269 3:51961502-51961524 ATGGAGAAGCTGAGGCTCAGAGG - Intronic
954708671 3:52494344-52494366 GTGGGGAAACTGAGGCTCAGAGG - Intergenic
954751464 3:52816578-52816600 GTGAAGAAACTGAGGCTCAGAGG + Intronic
955348608 3:58178533-58178555 GTGGAAAGACTGAGGCCCAGAGG + Intergenic
956742050 3:72282765-72282787 GTGGTAAAACTGAGGCTCTGAGG - Intergenic
956811866 3:72871235-72871257 AAGGAAAGACTGAGGGTCAGAGG - Intergenic
959973661 3:112434459-112434481 TTGAGTAAACTGAGGCTCAGAGG - Intergenic
960148443 3:114227814-114227836 ATGAAGAAACTGAGGGTAAGAGG + Intergenic
961328396 3:126125043-126125065 ATGGAGAAACTGAGGCTCACTGG + Intronic
961339606 3:126209179-126209201 ATGGAAAAACTGAGGCTCAGAGG + Intergenic
961427719 3:126861228-126861250 GTGGAAAAACTGTAGGTCTGTGG - Intronic
961649629 3:128410909-128410931 GTGGAGGAACTGAGGCACAGAGG + Intergenic
961658787 3:128457499-128457521 ATGCAGAAACTGAGGCTCAGAGG - Intergenic
961822992 3:129584727-129584749 CTGGGGAAACTGAGGCTCAGAGG - Intronic
961824288 3:129590760-129590782 ATGGGGAAACTGAGGCTCAGAGG + Intronic
962900717 3:139759136-139759158 TTAGGTGAACTGAGGGTCAGTGG - Intergenic
963722217 3:148875011-148875033 GTTGGAAAACTGAGGTTCAGAGG + Intronic
965454644 3:168883149-168883171 GTGGACAAACTAAGGGGAAGAGG - Intergenic
965921187 3:173916049-173916071 ATGTAAAAACTGAGGCTCAGAGG - Intronic
965935052 3:174098436-174098458 GAGGGTAAAAGGAGGGTCAGTGG + Intronic
966938603 3:184730900-184730922 GTACAGAAACTCAGGGTCAGTGG + Intergenic
967269454 3:187720725-187720747 CTGGGCAAACTGAGGTTCAGAGG + Intronic
967529305 3:190530904-190530926 GTGAAAAAACTGAAGCTCAGAGG + Intronic
967726858 3:192870262-192870284 GATGAGAAGCTGAGGGTCAGAGG - Intronic
967855550 3:194114866-194114888 ATGGAGAAACTGAGGCCCAGAGG + Intergenic
968079138 3:195834599-195834621 GTGGGTCCACTGAGGGTCAGAGG + Intergenic
968625338 4:1624359-1624381 GTGGAGAAACTGAGGCTCTGAGG + Intronic
968730781 4:2268340-2268362 GTGGAGAAACTGAGGCCCACAGG + Intergenic
968798599 4:2726704-2726726 GTGGATCACTTGAGGGTCAGGGG + Intronic
968939246 4:3629546-3629568 TTGGGGAAACTGAGGCTCAGCGG + Intergenic
969063440 4:4458194-4458216 GTGAAGAAACTAAGGTTCAGAGG + Intronic
969067235 4:4496148-4496170 ATGAAGAAACTGAGTGTCAGAGG + Intronic
969254827 4:5994588-5994610 GTGAGGAAACTGAGGCTCAGAGG + Intergenic
969462978 4:7338527-7338549 GTGGGCAAACTGAGGCCCAGAGG + Intronic
969626541 4:8308480-8308502 GTGGAGGAACCGAGGCTCAGAGG - Intergenic
970046953 4:11865264-11865286 GTGTAGAAACTGAGGCTCAGGGG + Intergenic
970109401 4:12620443-12620465 GTGTGTGAACTCAGGGTCAGGGG - Intergenic
976077921 4:81320512-81320534 GTGGTGAAGCTGAAGGTCAGTGG - Intergenic
977086435 4:92604753-92604775 GTGGGTAAGCTGAAGGACAGTGG - Intronic
978744494 4:112176419-112176441 GTGAAGAAACTGAGAGTCAGTGG + Intronic
980927989 4:139157876-139157898 CTGGATAAACTCGGGGCCAGTGG + Intronic
980981633 4:139659166-139659188 ATGGAGAAACTGAGGCTGAGAGG - Intergenic
982069942 4:151686251-151686273 GTGAGGAAACTGAGGGTCAGAGG + Intronic
982106869 4:152018777-152018799 GGGAATGAACTGAGGGGCAGTGG - Intergenic
982303202 4:153901037-153901059 GTGGGGAAACTGAGGCTTAGAGG + Intergenic
982368324 4:154605338-154605360 ATGGATAAGCTTAGGGACAGAGG - Intronic
983153694 4:164317790-164317812 GTGGGTAAACTGTGGATCAATGG + Intronic
983770489 4:171542618-171542640 GTGGAGAATCTGAAGGACAGGGG + Intergenic
985970372 5:3373463-3373485 GAGGATCAACTGAGGGACAAAGG + Intergenic
986567434 5:9128792-9128814 GTGGAGAAACTCTGGGGCAGTGG - Intronic
989128347 5:38078916-38078938 ATGGAGAAATTGAGGCTCAGAGG + Intergenic
989201396 5:38767976-38767998 GTGGAGCAACTGAGAGTCTGGGG + Intergenic
989431253 5:41358184-41358206 GAGGAGGAACTGAGGTTCAGAGG + Intronic
990373741 5:55148873-55148895 GTGAAGAAACTGAGGCTTAGAGG + Intronic
990855320 5:60260231-60260253 AGTGATAAACTGAGGCTCAGAGG + Intronic
990914936 5:60893455-60893477 GTGAACAAACTGAGGAGCAGAGG + Intronic
992207996 5:74449582-74449604 ATGAAGAAACTGAGGCTCAGAGG + Intergenic
992538537 5:77738384-77738406 ATGGGGAAACTGAGGGTCAGGGG - Intronic
992749215 5:79847146-79847168 GTAGAAAAACTGAGGGGCAGAGG + Intergenic
993132022 5:83910938-83910960 ATAGGTAAACTGAGGGTCATGGG - Intergenic
994267116 5:97730666-97730688 ATGTATAAACAGAGGCTCAGAGG + Intergenic
995575359 5:113525508-113525530 GTGAAGAAACTGAGGCTTAGAGG + Intronic
996389923 5:122948705-122948727 ATGGACAAACTGAGGTCCAGTGG + Intronic
996941772 5:129015462-129015484 ATGAATAAACTGAGAATCAGAGG + Intronic
997076633 5:130686498-130686520 GAGGAATAATTGAGGGTCAGTGG - Intergenic
997429988 5:133830912-133830934 ATGGAGAAACTGAGGCTCAGAGG - Intergenic
997721508 5:136081436-136081458 ATGAATAAACTGAGAATCAGTGG + Intergenic
998617818 5:143760278-143760300 ATGAGAAAACTGAGGGTCAGAGG + Intergenic
999116166 5:149165282-149165304 GTGGATAAACTATGGCTCAAGGG + Intronic
999562055 5:152814409-152814431 ATGGAAAAACTGAGGGACAGAGG - Intergenic
1000304638 5:159984209-159984231 GTGGATAAACTTAAAGTCATGGG - Intergenic
1000335606 5:160239227-160239249 GTGGGTAAACTGAGGACCAAAGG - Intergenic
1001225860 5:169944141-169944163 ATGGAGAAATTGAGGCTCAGGGG + Intronic
1001301562 5:170537432-170537454 GTGGAGAAACTGAGGCTCAGTGG - Intronic
1001314154 5:170630846-170630868 GTCCAGAAACTGAGGCTCAGAGG + Intronic
1001484597 5:172110713-172110735 ATGGGGAAACTGAGGCTCAGAGG - Intronic
1002574218 5:180162340-180162362 GTGGAGAAACTGAGTCCCAGAGG + Intronic
1002845552 6:941464-941486 ATGAAGAAACTGAGGGTCACAGG - Intergenic
1003452149 6:6244965-6244987 GTGGAGAAACTGAGTCACAGAGG + Intronic
1003812805 6:9803669-9803691 GTGGATAAAAGGAAGGTAAGAGG - Intronic
1005145841 6:22689233-22689255 GTGAAGAAACTGAAAGTCAGAGG - Intergenic
1005726970 6:28658850-28658872 CTGGATAAAATGCGGATCAGGGG - Intergenic
1006533625 6:34679077-34679099 ATGGATAAATTGCGGGTCATGGG - Intronic
1006615958 6:35327079-35327101 GTGAGGAAACTGAGGCTCAGAGG - Intergenic
1006901636 6:37506360-37506382 ATGAAGAAACTGAGGCTCAGAGG - Intergenic
1007254341 6:40518119-40518141 GTGAAGAAACTGAGGCCCAGAGG - Intronic
1007274616 6:40664096-40664118 ATGAAGAAACTGAGGCTCAGAGG + Intergenic
1007289516 6:40774826-40774848 GTGGAGACACTGAGGGTTCGGGG - Intergenic
1007527136 6:42506241-42506263 GTGGATACACACAGGGTTAGTGG - Intergenic
1007763618 6:44148626-44148648 GTAGATGTTCTGAGGGTCAGGGG - Exonic
1008286297 6:49655285-49655307 GGGGTTAAACTGAGTGACAGAGG - Intergenic
1011774730 6:90716998-90717020 TTGGAGAAACTGAGGCTCAGAGG + Intergenic
1012759474 6:103280064-103280086 ATGGATAAACTGAGGCTCAGAGG + Intergenic
1013081987 6:106821263-106821285 GTGGAGAAACTGAGGCCCAGAGG + Intergenic
1013985730 6:116190993-116191015 GTGAGGAAACTGAGGCTCAGAGG + Intronic
1014961592 6:127693052-127693074 ATGGGTAAAATGAGGGACAGTGG - Intergenic
1016384287 6:143515617-143515639 GTGAAGAAACTGAGGCACAGAGG - Intergenic
1016429103 6:143964297-143964319 TTTGATAAACTGAAGGTCAGAGG + Intronic
1016933792 6:149433818-149433840 ATGGATAAACTGAGGCTCACAGG - Intergenic
1017022201 6:150149272-150149294 ATGGAGAAAGTGAGGCTCAGAGG - Intronic
1017415819 6:154219497-154219519 TGGGATGAACTGAGGCTCAGCGG + Intronic
1017544854 6:155439444-155439466 ATGGGGAAACTGAGGCTCAGAGG + Intronic
1017607466 6:156149193-156149215 GTGAGAAAACTGAGGGTAAGTGG - Intergenic
1017719189 6:157233165-157233187 CTGGGGAAACTGAGGCTCAGAGG + Intergenic
1019196838 6:170288108-170288130 GTGGGGAAACTGAGGCCCAGAGG - Intronic
1019329483 7:455577-455599 GTGGGGAAACGGAGGCTCAGCGG - Intergenic
1019770376 7:2880627-2880649 CTGGAGAAACTGAGGGGCGGGGG - Intergenic
1019770878 7:2883055-2883077 ATGTAGAAACTGAGGCTCAGAGG - Intergenic
1019773076 7:2895996-2896018 ATGGGGAAACTGAGGCTCAGGGG - Intergenic
1019854149 7:3587210-3587232 GAGGAGAAATTGAGGGTCAGAGG + Intronic
1020814083 7:12882858-12882880 TTGAAGAAACTGGGGGTCAGAGG + Intergenic
1021712664 7:23431535-23431557 GTGGATTAACAGAGGGTCACAGG + Intronic
1022205384 7:28158726-28158748 TTGGGTAAACTGATGGTGAGAGG - Intronic
1023285575 7:38615611-38615633 GAGGATAATGTCAGGGTCAGAGG + Intronic
1024043733 7:45574155-45574177 GTGGGGAAACTGAGGCTCGGAGG + Intronic
1026066138 7:67074727-67074749 GTTGAGAAACTGAGGCTCAGAGG - Intronic
1026710744 7:72737127-72737149 GCTGAGAAACTGAGGCTCAGAGG + Intronic
1026986839 7:74560085-74560107 GTGGCTAAACAGAAGGGCAGAGG - Intronic
1028370100 7:90082185-90082207 GTGGGTAACCTGAGTGACAGCGG + Intergenic
1028543556 7:91972431-91972453 GTGTAGAAACTGTGAGTCAGGGG + Intronic
1029579576 7:101426631-101426653 CTGGAGAAACTGAGGCTCAGAGG - Intronic
1029593847 7:101526271-101526293 GTGGATCATCTGAGGTTGAGAGG - Intronic
1031442297 7:121809419-121809441 GTGGTTAACTTAAGGGTCAGAGG + Intergenic
1032463722 7:132130245-132130267 TTGGACTAACTGAGGGTCAGTGG + Exonic
1034871837 7:154692019-154692041 ATGGGGAAACTGAGGCTCAGAGG - Intronic
1035844109 8:2844781-2844803 GTGAAGAAACTTAGGGTTAGAGG - Intergenic
1038347690 8:26747388-26747410 GAAGGAAAACTGAGGGTCAGTGG - Intergenic
1038395921 8:27245343-27245365 ATGGGGAAACTGAGGCTCAGAGG + Intronic
1039085952 8:33780004-33780026 GTGGATAAACTGCATGTCACAGG + Intergenic
1039311454 8:36321924-36321946 CGGAAGAAACTGAGGGTCAGAGG + Intergenic
1039840402 8:41288977-41288999 TTGCATAAACTGTGGATCAGTGG - Intronic
1040551498 8:48440936-48440958 GTGGAGTTACTGAGGGGCAGAGG + Intergenic
1043482534 8:80667834-80667856 GTGGAGAAACTGAGGAACGGGGG - Intronic
1044727960 8:95208311-95208333 GTGGAGTCCCTGAGGGTCAGAGG + Intergenic
1045040115 8:98215597-98215619 GTGAGGAAACTGAGGCTCAGAGG + Intronic
1045418830 8:101993847-101993869 ATGAAGAAACTGAGGCTCAGAGG - Intronic
1046634801 8:116662605-116662627 GAGGATAAACTGTGGGTGAAGGG - Intronic
1046680595 8:117165180-117165202 GTTGAGAAACTGAAGTTCAGAGG - Intronic
1047438040 8:124851544-124851566 GTGGGGAAACTGAGGCCCAGAGG - Intergenic
1047816477 8:128469543-128469565 GAGGAAAAATTGAGGCTCAGAGG + Intergenic
1047859191 8:128946037-128946059 GTGAAGAAAGTGATGGTCAGAGG + Intergenic
1047904696 8:129460387-129460409 GGGGATAAGCTGTGGGGCAGGGG - Intergenic
1048193171 8:132308782-132308804 ATGGAGATACTGAGGATCAGAGG + Intronic
1048256997 8:132912670-132912692 GTGGGAAAACTAAGGCTCAGAGG + Intronic
1049204090 8:141355327-141355349 ATGAAGAAACTGAGGCTCAGAGG - Intergenic
1049354626 8:142181656-142181678 GTGGGAAAACTGAGGCTCTGAGG + Intergenic
1049420087 8:142512640-142512662 GTGAGGAAACTGAGGCTCAGAGG - Intronic
1049461838 8:142733606-142733628 ATGGGGAAACTGAGGCTCAGAGG + Intronic
1049484686 8:142848962-142848984 GTGTAGAAACTGTGAGTCAGGGG + Intronic
1049933936 9:482518-482540 ATGGGTAAACTGAGGCTCAGGGG + Intronic
1051182625 9:14427417-14427439 GAGGATAAACTGAGGTACAGAGG + Intergenic
1051551794 9:18338202-18338224 GTGGAAAAGTTAAGGGTCAGTGG - Intergenic
1052364940 9:27601807-27601829 GTTGATAAAATGAAGGTGAGGGG - Intergenic
1053197977 9:36135060-36135082 GTGGAGACAGTGAGGCTCAGCGG - Intergenic
1053297290 9:36923982-36924004 ATGAATAAACTGAGGCTCAAGGG + Intronic
1053415086 9:37942417-37942439 ATCGATAAAATGAGGGTCTGGGG - Intronic
1053435415 9:38070380-38070402 ATGGAGAAACTGAGGCCCAGAGG + Intergenic
1055440982 9:76335888-76335910 ATGAAGAAACTGAGGATCAGAGG + Intronic
1055963598 9:81843930-81843952 GTGAAGAAACTGAGCCTCAGAGG + Intergenic
1056564794 9:87761721-87761743 GTGATGAAACTGAGGCTCAGAGG + Intergenic
1057123968 9:92601740-92601762 GGGGATACACTGAGGGTGAAGGG + Intronic
1057431461 9:94998299-94998321 ATGGAAAAACTGAGTCTCAGGGG - Intronic
1057725490 9:97565183-97565205 GAGGAGAAACTGAGGCCCAGAGG - Intronic
1058809827 9:108628726-108628748 GTGGCAAAAGTGAGGCTCAGAGG - Intergenic
1059508717 9:114823795-114823817 AAGGGTAAACTGAGGCTCAGAGG + Intergenic
1060176166 9:121499168-121499190 GGGGATAAAGTGAGGGTCGCAGG - Intergenic
1060205708 9:121681604-121681626 GTGAGGAAACTGAGGTTCAGAGG + Intronic
1060274200 9:122169976-122169998 GGGGAGAAACTGAGGCGCAGTGG - Intronic
1060423754 9:123487871-123487893 ATGAAGAAACTGAGGCTCAGAGG + Intronic
1060496649 9:124124347-124124369 ATGGGGAAACTGAGGCTCAGAGG - Intergenic
1060593473 9:124833967-124833989 ATGGAGAAACTGAGGCTCAAGGG - Intergenic
1060737231 9:126073750-126073772 GTGGGAAAACTGAGGACCAGAGG + Intergenic
1060929342 9:127479151-127479173 GTGCAGAGACTGAGGCTCAGAGG + Intronic
1061008838 9:127943529-127943551 GTGAAGAAACTGAGGCTCAGAGG + Intronic
1061326088 9:129865589-129865611 ATGGACAGACTGAGGTTCAGGGG + Intronic
1061496155 9:130975619-130975641 ATGGATAAACTGCGTGTCACGGG - Intergenic
1061598167 9:131646200-131646222 GTGGGGAAACTGAGGCTTAGTGG + Intronic
1061824118 9:133247246-133247268 GTGGGGAGACTGAGGATCAGAGG + Intergenic
1062133055 9:134910494-134910516 GTGGTAAAACCGAGGCTCAGGGG - Intronic
1062372784 9:136248767-136248789 AGGGAGAAACTGAGGCTCAGAGG + Intergenic
1062526267 9:136979194-136979216 GTGGGTGACCTCAGGGTCAGGGG - Intronic
1185661652 X:1733274-1733296 GCCGATCACCTGAGGGTCAGGGG + Intergenic
1186069023 X:5797433-5797455 ATGGGTAAATTGAGTGTCAGAGG - Intergenic
1188903163 X:35759980-35760002 GTGTAGAAACTGTGAGTCAGGGG + Intergenic
1189130801 X:38496097-38496119 GTGAAGAAACTGAGGAACAGAGG + Intronic
1190058656 X:47196982-47197004 TTGGAGAAAATGAGGCTCAGAGG + Intronic
1190142241 X:47857943-47857965 GGGGAATAATTGAGGGTCAGGGG - Intronic
1190258572 X:48783450-48783472 ATGAAGAAACTGAGGCTCAGAGG + Intergenic
1190398656 X:50010029-50010051 CTGCATATACTGAGGGTGAGTGG + Intronic
1190711741 X:53076607-53076629 TTGGCCATACTGAGGGTCAGGGG - Exonic
1192145718 X:68680950-68680972 GTGAGGAAACTGAGGCTCAGAGG + Intronic
1192172326 X:68864738-68864760 ATGGGGAAACTGAGGCTCAGAGG + Intergenic
1192203200 X:69080219-69080241 GGGAAGAAACTGAGGTTCAGAGG - Intergenic
1192295130 X:69839374-69839396 CTGGATAAACTGAAGGGAAGAGG - Intronic
1192437596 X:71152542-71152564 ATGGGGAAACTGAGGTTCAGAGG - Intronic
1193212835 X:78827861-78827883 GTGAAGAAACTGAGGCTCAATGG - Intergenic
1194613621 X:96074599-96074621 GTGGAGAAACTGTGAGGCAGAGG - Intergenic
1195431201 X:104791303-104791325 GTGGATAAGCAGAGAGCCAGAGG + Intronic
1197255625 X:124259981-124260003 GTGGGGAAACTGAGGCCCAGAGG - Intronic
1198509243 X:137332711-137332733 CTGAAGAAACTGAGGCTCAGAGG - Intergenic
1198530122 X:137544319-137544341 GTGGGTAAAGTGAAGGTAAGAGG - Intergenic
1200374006 X:155760257-155760279 ATGAAGAAACTGAGGCTCAGAGG + Intergenic
1201525778 Y:14932543-14932565 ATGGGTAAACTGGGTGTCAGAGG + Intergenic