ID: 953277316

View in Genome Browser
Species Human (GRCh38)
Location 3:41514962-41514984
Sequence ACAGATATGCTGGCTGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 379}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953277314_953277316 0 Left 953277314 3:41514939-41514961 CCTTTTCTATGAGTCACTAAAGA 0: 1
1: 0
2: 0
3: 22
4: 211
Right 953277316 3:41514962-41514984 ACAGATATGCTGGCTGTGCATGG 0: 1
1: 0
2: 2
3: 33
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953277316 Original CRISPR ACAGATATGCTGGCTGTGCA TGG Intronic
900284873 1:1894277-1894299 ACAGATAAGCTGGAGGTGCTGGG - Intergenic
900629585 1:3626867-3626889 ACAGGAATACTGGCTGGGCACGG - Intronic
901166502 1:7225372-7225394 AGAGATCTGCTGGCCGGGCACGG - Intronic
901439148 1:9267108-9267130 ACAGATGTTCTGGCTGGGCGCGG - Exonic
901572806 1:10175263-10175285 ACAGATATGCAGTCTGTCCATGG - Intronic
901720498 1:11193473-11193495 ACACATCTACTGGCTCTGCAGGG + Intronic
902184454 1:14714669-14714691 GCAGGTATGCTGCCTGTGCCTGG - Intronic
902362280 1:15948463-15948485 CAAGACATGCTGGCTGTGCTGGG + Exonic
903096889 1:20984876-20984898 ACATATATGTTGACTGGGCACGG - Intronic
903099899 1:21020209-21020231 ACAGATATGATCACTGTGCCTGG - Intronic
903174138 1:21570550-21570572 TGAAATCTGCTGGCTGTGCAGGG + Intronic
903812013 1:26039823-26039845 CCAGATATGCAGGCTGTGCAGGG + Exonic
904250883 1:29223356-29223378 ACAGTTATACTTGCTGTGTAAGG + Intronic
904694766 1:32323010-32323032 ACAGACAGGCTGGCTGGGCACGG + Intronic
904754920 1:32763272-32763294 AAAAATATTCTGGCCGTGCACGG - Intronic
905549994 1:38829928-38829950 ACTGAAATTCTGGCTGGGCATGG + Intergenic
906006611 1:42478466-42478488 ACAGATTCTCTGGCCGTGCACGG + Intronic
906691420 1:47795269-47795291 AGAGATGTGCTGGCAGTGCCAGG + Intronic
907041852 1:51268019-51268041 AAAGATGTGATGGCTGGGCATGG - Intronic
907253131 1:53156561-53156583 ACAGTTCTGCAGGCTGTACAGGG - Intergenic
907479439 1:54734678-54734700 AAAGAAATTCTGGCTGGGCACGG - Intronic
907506584 1:54923489-54923511 CAAGAGATGCTGGCTGGGCAAGG - Intergenic
907703356 1:56811386-56811408 TTAGATAAGCTGGCAGTGCAAGG - Intronic
911240045 1:95455077-95455099 ACAGATATACTAACAGTGCACGG + Intergenic
911820983 1:102421823-102421845 AAAGTTATGCTTGCTGGGCATGG + Intergenic
912440955 1:109697623-109697645 TCAAATATTCTGGCTGGGCATGG + Intronic
912795497 1:112690648-112690670 ACAGAGATGTTGGCTGGGCACGG - Intronic
915726297 1:158020058-158020080 AAATAAATGATGGCTGTGCAGGG + Intronic
916046624 1:161004868-161004890 ATAGATATGGAGGCTGAGCACGG + Intronic
917783377 1:178424749-178424771 AAAAATATGAGGGCTGTGCATGG - Intronic
918229141 1:182512627-182512649 ACACTTATGCTGTCTGTGGATGG - Intronic
919885577 1:201931744-201931766 AAAGAAAGGCTGGCTGGGCACGG + Intronic
920530337 1:206697406-206697428 ACAGTTCTGCAGGCTGTACAAGG + Intronic
920537776 1:206750757-206750779 CAGGATATGCTGGCTGTGCTGGG + Intergenic
921621549 1:217331141-217331163 ACAGTTCTGCAGGCTGTACAGGG + Intergenic
921666401 1:217877528-217877550 ATACATATGCAGGATGTGCAGGG - Intergenic
922058147 1:222061855-222061877 ACATGTATGCTGCCTGTGAAGGG - Intergenic
922982337 1:229838136-229838158 ACTGAGATGATGGCTTTGCATGG + Intergenic
923370541 1:233307497-233307519 ACAGTTCTGCTGGCTGTACAAGG - Intergenic
923617919 1:235553047-235553069 ACATGTGTGCTGGCTGGGCACGG - Intronic
924148328 1:241100799-241100821 CCAGATATCGTGGGTGTGCATGG - Intronic
924391973 1:243571027-243571049 ACCAATATGTTGGCTGGGCATGG + Intronic
1062983973 10:1749410-1749432 ACAGCTATGATGAATGTGCAAGG + Intergenic
1063023958 10:2158932-2158954 ACAGTTCTGCAGGCTGTACATGG - Intergenic
1063268090 10:4476047-4476069 ACAGATGTGCTGCCTGAGAAGGG - Intergenic
1063370601 10:5519907-5519929 ACAGATCTGTTACCTGTGCATGG - Intergenic
1063467076 10:6253749-6253771 GGTGATATGCTGGCTGGGCACGG + Intergenic
1064379727 10:14830553-14830575 TCACATTTGCTGGCTGGGCACGG + Intronic
1064964173 10:20998968-20998990 GAAGATATGCTGGGTGTTCAGGG + Intronic
1065321945 10:24518540-24518562 ACAGACATGTTGGTTGTTCACGG + Intronic
1066288845 10:33995641-33995663 CAAGATATGCTTGGTGTGCAGGG + Intergenic
1066576383 10:36829697-36829719 ACAGATATGGTCGCTGGGCTTGG - Intergenic
1067496698 10:46767134-46767156 ACAAAAAAGCTGGCTGTGCACGG + Intergenic
1067580661 10:47443550-47443572 ATAGATATGGTGCCAGTGCAGGG - Intergenic
1067597955 10:47573270-47573292 ACAAAAAAGCTGGCTGGGCACGG - Intergenic
1069728528 10:70596563-70596585 ACGGCTGTGCAGGCTGTGCAGGG - Intergenic
1070596173 10:77834627-77834649 ACAGATTACCTGGCTGTGGAGGG + Intronic
1070611482 10:77936147-77936169 ACAGAGAATCTGGCTGGGCATGG + Intergenic
1070740583 10:78900540-78900562 ACAGCTTTGGGGGCTGTGCAGGG + Intergenic
1071094601 10:81958610-81958632 ACAGATATACAGGCTGGGCATGG + Intronic
1072620146 10:97074362-97074384 CCAGACAGGCTGGCTGTGCATGG + Intronic
1073202249 10:101745114-101745136 ACAGATATGCTGGAAGGGTAAGG + Intergenic
1073231761 10:101976941-101976963 ACAGAACTTCTGGCTGAGCATGG - Intronic
1073893179 10:108123738-108123760 ACACAAATGGTGGCTGTGGAAGG + Intergenic
1075217883 10:120554638-120554660 ACAGTTCTGCAGGCTGTACAGGG + Intronic
1075851562 10:125592548-125592570 AGAGAATTGCTGGATGTGCAGGG - Intronic
1075924523 10:126239999-126240021 ACAGATGTGCTGCCTGAGCTTGG - Intronic
1076482845 10:130796174-130796196 ACAGATATGAAGTCTCTGCAGGG - Intergenic
1077327078 11:1968537-1968559 ACAGATAGGGTGGCTGGGCGGGG + Intronic
1077498899 11:2900071-2900093 ACAGAAAGGCCGGCTGTGTAAGG - Intronic
1077926253 11:6684259-6684281 ACATATATGCAGGCCGGGCACGG + Intergenic
1079504514 11:21138387-21138409 AGAGATATGCTTTCTGTGCCAGG + Intronic
1079797823 11:24828531-24828553 ACAGGGATGGTAGCTGTGCAAGG - Intronic
1080674910 11:34416696-34416718 ACAGACTTTCTGGCTGGGCAAGG - Intergenic
1080944489 11:36956373-36956395 AAAGAGATCCTGGCTGGGCACGG + Intergenic
1081927314 11:46841708-46841730 AGTGATATGCTGGCTCGGCACGG + Intronic
1082974867 11:59061485-59061507 ACAGAGATGCTGTGTGTGCCAGG - Intergenic
1083067974 11:59945449-59945471 AGAGAAATGCTGGCTGGGCACGG + Intergenic
1085347116 11:75775348-75775370 ACAGCTATGCTAGGTGTGCCAGG - Intronic
1087750286 11:101999890-101999912 ATAAAAATGTTGGCTGTGCACGG + Exonic
1089383663 11:118053637-118053659 AGAGCTATGCTGGATGTCCAAGG - Intergenic
1089415413 11:118285167-118285189 AAAGATTTGATGGCTGGGCATGG - Intergenic
1091023908 11:132125085-132125107 ACAGATATGCGGGCAGTGTGAGG - Intronic
1091231384 11:133990074-133990096 ACAGAAATGCTGGCTCTCCTGGG + Intergenic
1091261976 11:134241749-134241771 ACAGAGCAGCTCGCTGTGCAAGG - Intronic
1202810060 11_KI270721v1_random:23717-23739 ACAGATAGGGTGGCTGGGCGGGG + Intergenic
1091420499 12:335749-335771 ACAGAGAGGCGGGCTGGGCACGG + Intronic
1091992979 12:4971873-4971895 ACAGTTCTGCAGGCTGTGCAAGG + Intergenic
1092868197 12:12782913-12782935 AAACAAATGCTGGCTGGGCATGG + Intronic
1094173301 12:27517314-27517336 ACGGACATACTGGCTGGGCACGG + Intergenic
1094408205 12:30141706-30141728 ACAAATCTGCAGGCTGTCCAGGG + Intergenic
1095539963 12:43297988-43298010 ACAGTAATGCTGGCCGGGCACGG - Intergenic
1095551259 12:43442546-43442568 TTAGAAATGTTGGCTGTGCATGG - Intronic
1096203327 12:49702011-49702033 ACATATATACTGGCAGGGCATGG + Intronic
1096760277 12:53836060-53836082 ACTGCTATGCTAGCTTTGCATGG + Intergenic
1097067442 12:56331088-56331110 AGAAAAATGCTGGCTGGGCATGG - Intronic
1097164207 12:57074277-57074299 AAAAAAATGCTGGCTGGGCATGG - Intronic
1099153686 12:79147127-79147149 AGATATATGCTGGCCGGGCACGG - Intronic
1100628146 12:96358302-96358324 ACAGATATGCAGATTATGCAGGG + Intronic
1100976765 12:100130766-100130788 ACAAAAATACTGGCTGGGCATGG + Intronic
1101213631 12:102559779-102559801 TCATATATGCTGGTTCTGCAGGG + Intergenic
1101830933 12:108255950-108255972 AGAGATATGTTGGCTGTTGAGGG - Intergenic
1102265921 12:111484724-111484746 ACATAAATACTGGCTGGGCATGG - Intronic
1103951326 12:124552974-124552996 AAACTTATGCTGGCTGGGCACGG - Intronic
1104347413 12:128013764-128013786 ACAGGAATTATGGCTGTGCATGG + Intergenic
1104877963 12:132049688-132049710 CCAGGAATGCTGTCTGTGCAAGG - Intronic
1104942224 12:132400525-132400547 ACAGATCTGCAGTCTGGGCAGGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105887372 13:24653417-24653439 ACAGATCTGTTGGCTTTGCTAGG - Intergenic
1106042488 13:26106474-26106496 AGAAACATGCTGGCTGGGCATGG - Intergenic
1106456780 13:29934823-29934845 ACAGACATGCTGTCTGTGCTGGG - Intergenic
1106536635 13:30650284-30650306 AAAGAAATGCTGGCCGGGCATGG + Intronic
1106808197 13:33333097-33333119 TCAGCTATGCTGGCTGGGTACGG + Intronic
1108559757 13:51631068-51631090 ACAGAAAAGCTTGCTGGGCATGG - Intronic
1108896589 13:55335754-55335776 ACAGTTCTGCAGGCTGTACAGGG - Intergenic
1109278763 13:60331335-60331357 ACAGATAAGATGGGTGTCCAGGG - Intergenic
1111008746 13:82284211-82284233 ACAGAAATGTCGGCTGGGCACGG - Intergenic
1111534768 13:89588995-89589017 ACAGCAAAGCTGGCTGGGCATGG + Intergenic
1112977443 13:105338388-105338410 ACATCTGTGCTGGATGTGCAAGG - Intergenic
1113057705 13:106287532-106287554 ACAGATTTGCTGGCAGCGCCGGG + Intergenic
1113202101 13:107877128-107877150 ACACAGATGGTGGCTGGGCATGG + Intergenic
1116431649 14:44853110-44853132 ATAGAAGTGCTGGCTGGGCACGG + Intergenic
1116605113 14:46982418-46982440 AAACAAATGCTGGCTGGGCATGG + Intronic
1117284481 14:54273577-54273599 AATGATATGCTAGCTGTGCCTGG - Intergenic
1117947086 14:61039659-61039681 ATAAATATGGTGGCTGGGCACGG - Intronic
1118336138 14:64854898-64854920 ACAGAGAGGCTGGCTGGGAAGGG + Intronic
1119817350 14:77581700-77581722 AAAGAGATGGTGGCTGGGCATGG - Intronic
1120024781 14:79570548-79570570 CCTGAGATGCTGACTGTGCAAGG + Intronic
1120640434 14:87004781-87004803 ACAAATATAGTGGCTGTGGATGG - Intergenic
1122174981 14:99910082-99910104 ACAGAAATGCAAGGTGTGCAGGG + Intronic
1202941843 14_KI270725v1_random:156414-156436 ACTTATATGCTGACTGTACACGG + Intergenic
1124208158 15:27740822-27740844 TCAGATCTGCTGACTGTGTAGGG - Intergenic
1126403188 15:48295404-48295426 ACAGAAAGGATGGCTATGCAGGG - Intronic
1127272450 15:57413574-57413596 ACTGAGATGCTGGCCGGGCATGG - Intronic
1128144217 15:65323404-65323426 ACAAATATGCAGTCTGGGCAGGG - Intergenic
1128575343 15:68770515-68770537 ACAGAGATGCTGGCTGTCTTGGG - Intergenic
1128611242 15:69075064-69075086 AAATATATGCTGGCTCTGGAGGG - Intergenic
1128891530 15:71336099-71336121 TCACATGTGCTGGCTGAGCAGGG - Intronic
1128959812 15:71990373-71990395 ATAGATTTGCTGGCTGGGCATGG - Intronic
1131124270 15:89845195-89845217 AAAATTATTCTGGCTGTGCATGG - Intronic
1131858046 15:96620009-96620031 ACTGATATTCAGGCTGTGCTTGG + Intergenic
1132091493 15:98951163-98951185 CCACATGTGCTAGCTGTGCAAGG - Intronic
1132375273 15:101324596-101324618 AGAGACATCCTGGCTGTCCAGGG - Intronic
1132907106 16:2288303-2288325 CCAGAATTGCTGGCAGTGCAGGG + Exonic
1133402014 16:5495083-5495105 ACACTTCTGCAGGCTGTGCATGG + Intergenic
1133581461 16:7148542-7148564 ACAGCTATGTTGTCTGTTCAGGG - Intronic
1134064119 16:11216026-11216048 ACAGTTCTGCAGGCTGTACAGGG - Intergenic
1134387370 16:13786368-13786390 ATAGCTATGATGGCTGGGCATGG - Intergenic
1134469241 16:14508237-14508259 ACAAATAGGCAGGCTGGGCATGG + Intronic
1134828515 16:17304419-17304441 ACAGAAATGCTGTATGTGGATGG + Intronic
1135330931 16:21559046-21559068 ACAGAAATGTTGGTTCTGCAGGG + Intergenic
1137249847 16:46733425-46733447 ACAGAAGAGCTGGCTGTGCTGGG + Intronic
1137923068 16:52511201-52511223 ACAGTAAGGCTGGCTGGGCACGG + Intronic
1138098417 16:54231906-54231928 TCAGAAATGCTGGATGTGTAAGG - Intergenic
1138978185 16:62234226-62234248 ACAAATATATTGGCTGGGCATGG + Intergenic
1139070918 16:63381476-63381498 ACAAATATGAAGGCTGGGCATGG - Intergenic
1140160200 16:72482376-72482398 AAAGAGATGTTGGCTGGGCACGG - Intergenic
1144065827 17:11623262-11623284 AAAGAAATGCTGGCCGGGCACGG - Intronic
1146604926 17:34249978-34250000 AGAGCTATGCTGGCTGAGCTGGG - Intergenic
1148351288 17:46943669-46943691 ACAGCTTTGCTGGCCCTGCATGG - Intronic
1149300181 17:55298038-55298060 AAAGAAATGCTGGCTGGGCGCGG - Intronic
1149337440 17:55650468-55650490 ACAGTTCTGCAGGCTGTACAGGG - Intergenic
1150468396 17:65415020-65415042 ACAGACAAGCTGGGTGAGCATGG + Intergenic
1150550430 17:66204634-66204656 CCAGAAATGCTGTCTGGGCAGGG - Intergenic
1150557031 17:66263568-66263590 ACAGTTATTTTGGCTGGGCATGG + Intergenic
1153697947 18:7663557-7663579 ACAGATCTGCAGTCTGGGCAGGG + Intronic
1153864499 18:9251501-9251523 AGAAAAATGCTGGCTGGGCATGG + Intronic
1155201040 18:23518006-23518028 ACAGGAATGCTGGCTGGGCACGG - Intronic
1157342709 18:46793764-46793786 ACAGATAAGCTGCCTCTGCTGGG + Intergenic
1157943301 18:51952884-51952906 TCAGATATGCTAGCAGTGCAAGG - Intergenic
1158487668 18:57882013-57882035 ACAGCTATGCAGGCAGTGAAGGG - Intergenic
1158531085 18:58262336-58262358 TAAGAAATGCTGGCTGGGCACGG + Intronic
1158805650 18:60968861-60968883 ACAGAGATGCTGACTGTGTAGGG - Intergenic
1159001305 18:62977924-62977946 CCAGCTATGCTTGCTGTGTAAGG + Intronic
1160151358 18:76396910-76396932 AGACATAAGCTGCCTGTGCAAGG + Intronic
1160572184 18:79825850-79825872 ACAGACAGGCTGACAGTGCACGG - Intergenic
1160587024 18:79918544-79918566 ACAGATCTGCTCGCTGTGGCGGG - Intronic
1161676617 19:5654029-5654051 ACAGACATGTTGGCTGGGCGTGG - Intronic
1161959910 19:7517432-7517454 ACAGGTATACTGGCCGGGCATGG + Intronic
1163036803 19:14574403-14574425 GCAGCTGTGCAGGCTGTGCACGG - Intergenic
1163065486 19:14789736-14789758 ACAGAAGTGCTGGCCGGGCACGG - Intergenic
1163080133 19:14933368-14933390 ACAGATTTCCAGGCTGGGCATGG - Intergenic
1163197158 19:15730363-15730385 AATGATATACTGGCTGGGCACGG - Intergenic
1165217463 19:34286507-34286529 ACAGAAAGGTTGGCTGGGCACGG - Intronic
1166772031 19:45289478-45289500 ACAAATAAGTTGGCTGGGCACGG + Intronic
1168234008 19:55050576-55050598 ACAGACGTGCTAGCTGGGCATGG - Intronic
1168665333 19:58200847-58200869 ACAGTTCTGCAGGCTGTACAAGG + Intronic
927008392 2:18876059-18876081 ACATATATTCTGGCTGGACAGGG - Intergenic
927296948 2:21465693-21465715 ACAGGTATGTTGGTTGTTCATGG + Intergenic
927754497 2:25697918-25697940 ACAGAGATGCTGCCTGCGGAAGG + Intergenic
928478507 2:31655912-31655934 ACAAAAATGCTGGCTGTGAGGGG + Intergenic
928899692 2:36303859-36303881 AAAGATTTCCTGGCTGGGCACGG + Intergenic
929653584 2:43706905-43706927 AATCATATGCTGGCTGGGCACGG + Intronic
929897011 2:45969417-45969439 ACTGTCATGCTGGCTGAGCACGG + Intronic
931445582 2:62324508-62324530 ATAGATAAGCTTGCTGTGCAGGG + Intergenic
931598673 2:63978908-63978930 ATAGATAATCTGGCTGGGCATGG - Intronic
931764347 2:65441361-65441383 ACAAATACCCTGGCTGGGCACGG - Intergenic
932967369 2:76492391-76492413 ACAGACAAGCAGGCTGGGCACGG - Intergenic
933149206 2:78893894-78893916 AAAGAAATCCTGGCTGGGCATGG + Intergenic
933541158 2:83644266-83644288 ACAGAAAAGATGGCTGTGCAAGG - Intergenic
934113194 2:88761114-88761136 ACAGATATGCATGCTGTTTATGG - Intergenic
935004473 2:99058745-99058767 TCAGAAATCCTGGCTGGGCATGG + Intronic
935167140 2:100579582-100579604 ACAGTTCTGCTGGCTATGAAAGG + Intergenic
935841011 2:107110511-107110533 ACAGTTCTGCAGGCTGTACAGGG + Intergenic
937938777 2:127268551-127268573 AAAGAAATCCTGGCTGGGCACGG - Intronic
938450130 2:131411143-131411165 ACAAATGTGCAGGATGTGCAGGG - Intergenic
939394894 2:141615991-141616013 AAAAAAATGCTGGCTGGGCATGG + Intronic
939973184 2:148685468-148685490 AAAGTTATGCTGGCTGGGCACGG + Intronic
940086735 2:149867925-149867947 AAAGACATACTGGCTGGGCATGG + Intergenic
941696160 2:168553233-168553255 ACAGAGATGCTGGATCTGCTTGG - Intronic
941870535 2:170380450-170380472 ACCGATATACTGGCTGTTAAGGG + Intronic
942092612 2:172508569-172508591 TCAGTTATGCTGCCTGTGCTGGG + Intergenic
942375681 2:175334347-175334369 ACACATATGCTGTCTCTGGAAGG - Intergenic
943474035 2:188332607-188332629 ACAGATGTGCTGTCTATGCCTGG + Intronic
944312904 2:198254577-198254599 ACTGATATGCTGTCTGTGCCAGG - Intronic
945406062 2:209450230-209450252 AAAGGTAAGTTGGCTGTGCACGG - Intronic
946263834 2:218521172-218521194 ACAGTTCTGCAGGCTGTACAGGG - Intronic
946410671 2:219513717-219513739 ACAGATATGCAAGCTGGCCAGGG + Intergenic
947642485 2:231714726-231714748 GCAGATACCCAGGCTGTGCAGGG - Intergenic
947974719 2:234355723-234355745 ACAGATTTCCTGAATGTGCAGGG + Intergenic
948445893 2:238032639-238032661 AAAAACATGCTGGCTGGGCATGG + Intronic
948544547 2:238717454-238717476 ACAGTTCTGCTGGCAGAGCAGGG + Intergenic
948614071 2:239187134-239187156 ACACAGATGCTGGCTGAGGATGG - Intronic
948652478 2:239457098-239457120 ACATAAATCCAGGCTGTGCAGGG - Intergenic
948768692 2:240236412-240236434 AGAGACATGCTGGCTGAGGAGGG - Intergenic
948776526 2:240291885-240291907 ATATATATGCTGGCTTTTCAAGG - Intergenic
1168780826 20:488293-488315 ACTGATGTGCAGGCTGGGCACGG - Intronic
1169430369 20:5530991-5531013 TTAGAGATGCTGGCTGGGCACGG - Intergenic
1171202738 20:23255086-23255108 ACACACATGCTGCCTGTCCATGG + Intergenic
1171343478 20:24448088-24448110 AGAGATAAGCTTGCAGTGCAGGG + Intergenic
1171386069 20:24770173-24770195 ACAGATCTGCTCGCAGTGCACGG + Intergenic
1172839907 20:37896587-37896609 TTAGAGATGCTGGCTGGGCATGG + Intergenic
1173343672 20:42178224-42178246 ACAGATCTTCTGGCTGGGCACGG - Intronic
1173840215 20:46152127-46152149 ATTGATCTGCTGGCTGTGCCAGG - Intergenic
1174548902 20:51346770-51346792 ACAAATATGCAGTCTGGGCAAGG + Intergenic
1176518808 21:7809160-7809182 ACAGACCAGCTGGCTGGGCATGG + Intergenic
1177358972 21:20045049-20045071 ACAGACATGCTGGCAGGGAAGGG - Intergenic
1177754664 21:25331988-25332010 ATAGTTATGATGGCTGGGCACGG + Intergenic
1178652836 21:34439173-34439195 ACAGACCAGCTGGCTGGGCATGG + Intergenic
1180198193 21:46209661-46209683 GCAGCCATGCTGGCCGTGCAAGG - Intronic
1180646926 22:17347056-17347078 ACAGTCAGGCTGGCTGGGCATGG - Intergenic
1181099577 22:20530490-20530512 ACAGAGAAGCTGGCTGTCCTGGG + Intronic
1182315491 22:29444143-29444165 ACAGAACTGCTGGATGTGCAGGG - Intergenic
1182507065 22:30791260-30791282 AGAGATGTGTTGGCTGGGCATGG - Intronic
1182759834 22:32713538-32713560 ACAGATATCCCGGCTGGGCGCGG + Intronic
1183858959 22:40655177-40655199 ACAGATTTGCTGGCTGGGTACGG + Intergenic
1184398494 22:44259905-44259927 TTAGATATGCTTGCAGTGCAGGG - Intronic
949333395 3:2946998-2947020 ACAGAAATGCAGGCTGGCCAGGG - Intronic
950413159 3:12852211-12852233 ACAAAAAAGCTGGCTGGGCACGG - Intronic
952172580 3:30825083-30825105 AAAGGTATGTTTGCTGTGCAAGG + Intronic
952382871 3:32818107-32818129 CCAGATCTGCTTGCTGTGCAAGG + Exonic
952806969 3:37364881-37364903 TTAGAAATGCTGGCTGGGCATGG - Intronic
953245413 3:41186720-41186742 AAAAATATGCTGGCTGGACATGG + Intergenic
953277316 3:41514962-41514984 ACAGATATGCTGGCTGTGCATGG + Intronic
953340543 3:42130877-42130899 CCACATACCCTGGCTGTGCAAGG - Intronic
953992152 3:47492277-47492299 ACAGATCTTCTGGCTGGGCACGG + Intergenic
954115961 3:48466920-48466942 ACAGCTGTGCTGGCAGCGCATGG + Exonic
957395644 3:79633474-79633496 ACAAATATGTAGGCTGGGCATGG - Intronic
957819357 3:85350440-85350462 GCAGAAATACTGGCTGTACAGGG - Intronic
958067741 3:88565986-88566008 AAAGATATACAGGCTGCGCACGG + Intergenic
958516560 3:95123590-95123612 ATAGATAAGCTAGCAGTGCAAGG + Intergenic
958637927 3:96769193-96769215 ACTGAGATGATGGCTGGGCATGG + Intergenic
958814955 3:98904296-98904318 ACAGATGTGGTGGCAGAGCAAGG + Intergenic
959001747 3:100971957-100971979 ACAGAAATGCGGGCTGAGAAGGG + Intronic
961477787 3:127159376-127159398 ACAGATGTGCTAACTCTGCAAGG - Intergenic
962547411 3:136451471-136451493 AAAGGTATGCAGGCTGGGCATGG + Intronic
962586120 3:136844066-136844088 ACAAATTTGCTGGCCGGGCACGG + Intronic
962810830 3:138958069-138958091 ATAGATATGATGTCTGTGCCTGG - Intergenic
962972969 3:140421975-140421997 ATAGATCTGGTGGCTGAGCAGGG + Intronic
963892861 3:150655306-150655328 ACAGAATTTCTGGCTGGGCATGG - Intergenic
966406132 3:179600348-179600370 ACATAAATGTTGGCTGGGCACGG + Intronic
966489946 3:180516714-180516736 ACACACATGCTGGCAGGGCAGGG - Intergenic
967296586 3:187971078-187971100 AGGGAAATCCTGGCTGTGCAGGG + Intergenic
968670320 4:1846553-1846575 ACATAAATGCTGGCCGGGCACGG - Intronic
968765077 4:2463902-2463924 ACAGATAAGCTAGATGTCCAGGG + Intronic
969177247 4:5408024-5408046 ACAGATTTGGTGTCTGTGGAGGG - Intronic
969977210 4:11116050-11116072 AGAAATATGCTGCATGTGCAGGG - Intergenic
971238471 4:24865558-24865580 ACATATTTTTTGGCTGTGCAAGG + Intronic
971528309 4:27651373-27651395 AAAGATATTGTGGCTGTTCAAGG - Intergenic
976738301 4:88333041-88333063 ACTATTATGCTGGCTGGGCATGG - Intergenic
977565685 4:98578243-98578265 ACAGATGTGTTGGCTCTGCAGGG - Intronic
980922845 4:139104217-139104239 ACAGGAATGTTGGCTGGGCACGG + Intronic
981048628 4:140289754-140289776 ACAGAGATGGAGGCTGTGTATGG - Intronic
981339196 4:143600839-143600861 GCAGAGATGTTGGCTGTGCGTGG - Intronic
981768696 4:148281748-148281770 ACAAGTATCCTTGCTGTGCAGGG + Intronic
981889092 4:149715312-149715334 TCAGTAATGCTGGCTGTGGAGGG + Intergenic
981993034 4:150946086-150946108 AGAAATATGCCGGCTGGGCATGG - Intronic
986645411 5:9912076-9912098 AGAGATGTGCTTTCTGTGCAGGG - Intergenic
986665637 5:10101470-10101492 ATAAATATGCTGGCCGGGCACGG - Intergenic
990047679 5:51454599-51454621 ACTGTTAAGCTGGCTGAGCATGG - Intergenic
990325797 5:54674158-54674180 TCAGATATGGTGGCAGTGCCAGG - Intergenic
990577666 5:57138704-57138726 ATATATACGCTGGCTGGGCAGGG - Intergenic
992260615 5:74966614-74966636 TTAGATAAGCTGGCAGTGCAGGG - Intergenic
992408195 5:76479443-76479465 ACAGACCAGCTGGCTGTGCTTGG + Intronic
993907382 5:93638520-93638542 ATAGAAATGCAGGCTGGGCACGG + Intronic
994283843 5:97939275-97939297 ACAGTTATGTAGGCTGTACAAGG - Intergenic
997966101 5:138357648-138357670 ACAAAAATGTTGGCTGGGCATGG - Intronic
998165998 5:139844268-139844290 ACAGATGTGCTTCCTGAGCATGG + Exonic
998706719 5:144770407-144770429 AAAGATTTGTTGGCTGGGCACGG - Intergenic
999297829 5:150471486-150471508 ACATATATTTTGGCTGGGCAAGG - Intergenic
999422836 5:151459538-151459560 AAAGCTATGCTGGCTGTGTGGGG + Intronic
999949570 5:156634391-156634413 ATACATATGCAGGATGTGCAAGG - Intronic
999983129 5:156976890-156976912 ATAGATATGAAGGCTGGGCATGG - Intergenic
1000743058 5:164994403-164994425 ACAAAGATCCTGGCTGGGCATGG - Intergenic
1001089525 5:168727027-168727049 AGAAATATGCTGGCTGGGCACGG + Intronic
1001751872 5:174137463-174137485 TCAGATGTGCGGGCTGTGCTGGG + Intronic
1002988130 6:2211069-2211091 ACAGTTATGCAGGCTGTACAGGG - Intronic
1004047971 6:12044708-12044730 ACAGGTGTGCTGGCTTTGAATGG - Intronic
1005692465 6:28320609-28320631 GCAGAAATGGTGGCCGTGCAAGG - Intergenic
1006401490 6:33820532-33820554 CCACATATGGTTGCTGTGCATGG + Intergenic
1007148932 6:39668131-39668153 ACAGTTCTGCAGGCTGTACAGGG - Intronic
1007319976 6:41021025-41021047 ACAGATATGGTGGCTGGTGAGGG + Intergenic
1009314856 6:62205386-62205408 AAAGATATGGTGGCTGAGTAAGG - Intronic
1009421067 6:63465470-63465492 ATAGATGTGCAGGCTGAGCATGG - Intergenic
1010981200 6:82371911-82371933 ACAGAACTGATGGCTGGGCACGG - Intergenic
1013437402 6:110124614-110124636 ACAGATGTACTGGCTGGGTATGG + Intronic
1013515930 6:110885962-110885984 AAAGATTTGCCGGCTGGGCACGG + Intronic
1013529279 6:111004101-111004123 ATAGATGAGCTGGCTGGGCATGG - Intronic
1014964470 6:127729977-127729999 AAAGATAAACTGGCTGAGCATGG + Intronic
1015250332 6:131120673-131120695 ACAAAAAAGCTGGCTGGGCACGG - Intergenic
1016520268 6:144938961-144938983 AGAGTTCTGCTGGCTGGGCACGG - Intergenic
1016667277 6:146656893-146656915 ACACATATACTCTCTGTGCAAGG + Exonic
1017068947 6:150555325-150555347 AGAGATGTGCTGGCTGGGCACGG - Intergenic
1017837071 6:158188242-158188264 ACAGGTATGATGGCTGGGGAGGG - Intronic
1017859750 6:158384576-158384598 AAATAAATGCTGGCTGGGCATGG - Intronic
1018151797 6:160946581-160946603 ACAGGTATGCTGGGGGAGCAGGG - Intergenic
1019142852 6:169959353-169959375 ACAGACATGCTGGGGCTGCACGG - Intergenic
1019888941 7:3929850-3929872 ACAGTCATGCAGGCTGTTCATGG + Intronic
1020373824 7:7462566-7462588 ACAGAAATGCAGGCTGAGCACGG + Intronic
1020489003 7:8756024-8756046 CCAGATGTGATGGCTGTGGAAGG + Intergenic
1020502865 7:8944948-8944970 ACAGTTCTGCAGGCTGTACAAGG + Intergenic
1021511604 7:21439290-21439312 ACAGATTTGCTTGCTCTGTAGGG - Intronic
1022196959 7:28077978-28078000 ACTGCAATGATGGCTGTGCATGG + Intronic
1023763536 7:43489163-43489185 CCAGATCTGCTGGCTGAGCTCGG - Intronic
1023846905 7:44126766-44126788 TCAGATATCTTGGCTGGGCACGG - Intergenic
1024367824 7:48543331-48543353 ACAAATAGGCTAGCTGGGCACGG + Intronic
1024497833 7:50068589-50068611 AAAGAGAAGCTGGCTTTGCAAGG - Intronic
1027566416 7:79800444-79800466 AAATTTATTCTGGCTGTGCATGG + Intergenic
1029970827 7:104787466-104787488 ACAGATATGGTGTCTGAGGAAGG + Intronic
1032264042 7:130358287-130358309 ACACATATGCAGGTTGGGCATGG - Intronic
1032398755 7:131609251-131609273 ACAGAGTTTCTGGCTGGGCACGG - Intergenic
1033070344 7:138196217-138196239 ACGGTCATGCTGGCTGGGCATGG + Intergenic
1033140931 7:138825894-138825916 ACAGATTTTCAGGCTGGGCATGG + Intronic
1033323409 7:140360441-140360463 TCAGATATGGAGGCTGGGCACGG + Intronic
1033494125 7:141876856-141876878 ACAGGCTTGCTGGCAGTGCAAGG + Intergenic
1033541387 7:142358923-142358945 AGAGAGCAGCTGGCTGTGCAGGG - Intergenic
1033802812 7:144920752-144920774 AGAGACATGCTGGCTGGGCGTGG + Intergenic
1034135142 7:148761215-148761237 ATAGATATCCTGGCTGGGCGTGG + Intronic
1034296012 7:149972988-149973010 ACAGACATGCTGCCCATGCACGG - Intergenic
1034417278 7:150971771-150971793 ACAGTCAGGCTGGCTGAGCACGG + Intronic
1034496741 7:151427683-151427705 ACACAAATGCTCGCTGTTCAGGG + Intergenic
1034699475 7:153083838-153083860 CCAGTTCTGCAGGCTGTGCAGGG + Intergenic
1035148769 7:156848639-156848661 AGAGAAATACTGGCTGGGCATGG + Intronic
1035706914 8:1682762-1682784 CTAGATATCCTGGCTGGGCATGG - Intronic
1035715537 8:1751458-1751480 AGAAATATGCTGGCTGTGCATGG + Intergenic
1037365370 8:18116324-18116346 ACAAATATGCAGGCTGGGCGCGG - Intergenic
1038170722 8:25128926-25128948 ACACACATGCTGGCGGGGCAAGG - Intergenic
1038436486 8:27540184-27540206 ACAGTTAAGCTGGCTGGGAAAGG + Intronic
1039529549 8:38248349-38248371 ACAAATCAGCTGGCTGGGCACGG - Intronic
1040690849 8:49936856-49936878 ACAGTTATCCTGGCTGGGTATGG + Intronic
1040871761 8:52107054-52107076 ACAGCTCTGCAGGCTGTACATGG + Intergenic
1041010911 8:53542526-53542548 AAATAAATGCTGGCTGTGTAAGG + Intergenic
1041098387 8:54372438-54372460 ACAGACATGCAGGCTGGGCGTGG + Intergenic
1041236664 8:55809723-55809745 AAAGAAATGCTGGCTGGGCACGG - Intronic
1041506934 8:58609462-58609484 ACACAGATGCTGCCTGTGAAGGG + Intronic
1043823073 8:84892317-84892339 ACTGATTTCCTGGCTGGGCATGG + Intronic
1043823934 8:84902152-84902174 ACAGTTCTGCAGGCTGTACAGGG + Intronic
1043854403 8:85248165-85248187 AGAATTATGCTGGCTGGGCACGG + Intronic
1044114853 8:88322965-88322987 TCAAATATGCTGGCTGTTTAGGG - Intronic
1045236081 8:100353661-100353683 ACAGTTCTGTTGGCTGTACAAGG + Intronic
1045842254 8:106593917-106593939 TGAGATATGGTGGCTGTGCAGGG - Intronic
1046320797 8:112571576-112571598 GCAGAAATGCAGGCTGGGCATGG + Intronic
1048077764 8:131091780-131091802 ATAAATATACTGGCTGGGCATGG - Intergenic
1048569469 8:135639672-135639694 ACAGTTCTGCAGGCTGTACAGGG + Intronic
1049489806 8:142889826-142889848 ACAGTTCTGCAGGCTGTACAGGG + Intronic
1049629784 8:143647450-143647472 ACAGCAAGGCTGGCTGGGCATGG - Intronic
1049807915 8:144549256-144549278 ACAGCCATGCCTGCTGTGCAGGG + Intronic
1049882578 8:145076455-145076477 AAAGAAATGTTGGCTGGGCACGG + Intergenic
1050851050 9:10286887-10286909 ACAAACATGTAGGCTGTGCACGG - Intronic
1050937325 9:11414400-11414422 CCAGGCATGCTGGCTGTGCAGGG - Intergenic
1053242993 9:36511717-36511739 ATAGAAATGCAGGCTGGGCATGG - Intergenic
1054839815 9:69725297-69725319 AAAGATGTTCTGGCTGTGCGTGG + Intronic
1056400858 9:86225773-86225795 AGAAATATGCTGGCTGGGCATGG - Intronic
1057038380 9:91829250-91829272 GCAGACATGTTGGCTGGGCACGG + Intronic
1057129680 9:92645098-92645120 AAAGAAATTCTGGCTGGGCATGG + Intronic
1057387621 9:94618330-94618352 AAAAATATCCTGGCTGGGCACGG + Intronic
1058261824 9:102842921-102842943 ACCGATTTGCAGTCTGTGCATGG + Intergenic
1058430739 9:104916833-104916855 ACATATTTTCTGGCTGGGCACGG - Intronic
1058446111 9:105056782-105056804 ACATGGATGCTGGCTGGGCACGG - Intergenic
1060775389 9:126369941-126369963 AAAAACATGCTGGCTGGGCATGG - Intronic
1062743847 9:138198426-138198448 AAAGAAATGTTGGCTGGGCACGG + Intergenic
1203611340 Un_KI270749v1:8567-8589 ACTTATATGCTGACTGTACACGG - Intergenic
1185705158 X:2261479-2261501 ACAGAGATCGTGGCTGGGCACGG + Intronic
1185932370 X:4217301-4217323 ATATATATGTTAGCTGTGCATGG + Intergenic
1188036394 X:25322237-25322259 ACAGATATCTTGGCTGGTCATGG - Intergenic
1188988896 X:36792798-36792820 ACATAAATGCTGTCTGTGCTGGG - Intergenic
1189920355 X:45897111-45897133 ATAAATAGGCTGGCTGGGCATGG - Intergenic
1190159090 X:48017189-48017211 ACAGGGCTGCTGGCTGCGCAGGG - Intronic
1190859257 X:54328377-54328399 TCAAATATGCAGGCTGGGCACGG + Intronic
1192366040 X:70474099-70474121 ATAGATAGGCTGGCTGTGATGGG + Intronic
1192468340 X:71374363-71374385 CAAGATATGATGGCTGGGCATGG - Intronic
1193300369 X:79881672-79881694 ACAGGTATGCTGGTGGGGCAGGG - Intergenic
1193911600 X:87313494-87313516 ACAGTTCTGCAGGCTGTACAGGG + Intergenic
1194295025 X:92116876-92116898 ATAAATTTGCTGGCTGAGCACGG - Intronic
1195672818 X:107483895-107483917 ACATATACACTGGGTGTGCAAGG + Intergenic
1195766679 X:108303528-108303550 ACAGATATGCAGAGTGAGCATGG + Intronic
1196504916 X:116430230-116430252 AGAGATATTCTGGCCGTGCGTGG - Intergenic
1196521548 X:116679695-116679717 ACAGAGATCCGGGCTGGGCACGG + Intergenic
1197804340 X:130384848-130384870 TCGAATCTGCTGGCTGTGCATGG + Exonic
1198024110 X:132688037-132688059 TCAGAAATGTTGGCTGGGCATGG - Intronic
1198396482 X:136224108-136224130 AAAGATAAACTGGCTGGGCATGG + Intronic
1199235369 X:145486887-145486909 ACAGTTTTGCAGGCTGTACAAGG + Intergenic
1199733417 X:150660689-150660711 ACAGTTCTGCAGGCTGTACAAGG + Intronic
1199932704 X:152540525-152540547 ACAGATATGATACCTGTGAAAGG + Intergenic
1200612524 Y:5341396-5341418 ATAAATTTGCTGGCTGAGCACGG - Intronic