ID: 953278440

View in Genome Browser
Species Human (GRCh38)
Location 3:41527980-41528002
Sequence AAATGTATGACACAGCTATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 175}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953278437_953278440 16 Left 953278437 3:41527941-41527963 CCATCAGAAAAGATAAAAAGTTT 0: 1
1: 0
2: 4
3: 57
4: 887
Right 953278440 3:41527980-41528002 AAATGTATGACACAGCTATGTGG 0: 1
1: 0
2: 1
3: 16
4: 175
953278435_953278440 26 Left 953278435 3:41527931-41527953 CCCTGGAGGACCATCAGAAAAGA 0: 1
1: 0
2: 2
3: 11
4: 171
Right 953278440 3:41527980-41528002 AAATGTATGACACAGCTATGTGG 0: 1
1: 0
2: 1
3: 16
4: 175
953278439_953278440 -10 Left 953278439 3:41527967-41527989 CCTCGAGAATTATAAATGTATGA 0: 1
1: 0
2: 2
3: 15
4: 198
Right 953278440 3:41527980-41528002 AAATGTATGACACAGCTATGTGG 0: 1
1: 0
2: 1
3: 16
4: 175
953278438_953278440 -9 Left 953278438 3:41527966-41527988 CCCTCGAGAATTATAAATGTATG 0: 1
1: 0
2: 1
3: 21
4: 170
Right 953278440 3:41527980-41528002 AAATGTATGACACAGCTATGTGG 0: 1
1: 0
2: 1
3: 16
4: 175
953278436_953278440 25 Left 953278436 3:41527932-41527954 CCTGGAGGACCATCAGAAAAGAT 0: 1
1: 0
2: 2
3: 17
4: 154
Right 953278440 3:41527980-41528002 AAATGTATGACACAGCTATGTGG 0: 1
1: 0
2: 1
3: 16
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953278440 Original CRISPR AAATGTATGACACAGCTATG TGG Intronic
900421659 1:2558454-2558476 AAATGTGTGACCCAGGTAAGAGG + Exonic
903466574 1:23556138-23556160 AAATGCATCACACACCTACGAGG - Intergenic
908015569 1:59830603-59830625 AAATGTAAGACCCAACTATTAGG - Intronic
908038179 1:60078756-60078778 AGATGTATTACAAAGATATGGGG + Intergenic
910228438 1:84961547-84961569 AAATGTATGGCCCAGCATTGGGG + Intronic
911656325 1:100448104-100448126 AAATGTAAGCCACAGTGATGAGG - Intronic
911801379 1:102142784-102142806 AAATGTATGACACACCTTTATGG - Intergenic
911925835 1:103831397-103831419 AAATGGATGAAACAGATATATGG - Intergenic
912738443 1:112171381-112171403 GAATGAAAGACACAGCCATGTGG - Intergenic
913612896 1:120525587-120525609 AAATGTAGGTCACAGGTTTGTGG + Intergenic
914578291 1:148996660-148996682 AAATGTAGGTCACAGGTTTGTGG - Intronic
914850590 1:151311084-151311106 ACACATATGACACAGCAATGGGG - Intronic
915763002 1:158334372-158334394 AAATGTGTGACATTGCTATGTGG - Intergenic
917765138 1:178207865-178207887 AAATGTGTGCTACAGCTATATGG - Intronic
918712465 1:187748469-187748491 AAAAGCATGACACAGGTATCTGG - Intergenic
919192391 1:194239267-194239289 AAAAGTATGAAATGGCTATGGGG - Intergenic
924167447 1:241299333-241299355 AAATGTATGAATCATCTAGGAGG - Intronic
1063646653 10:7890777-7890799 AAATGTATGACGTAGGTGTGAGG - Intronic
1063713402 10:8503381-8503403 AAACTCATGGCACAGCTATGAGG + Intergenic
1064240916 10:13627630-13627652 AAATGTATCATACCGCTCTGTGG + Intronic
1068492450 10:57741154-57741176 AAATGTATGAGACATCTAGAAGG - Intergenic
1068855791 10:61796003-61796025 AAATGTTTGTCACAGTTAGGAGG + Intergenic
1071801868 10:89072498-89072520 ATAAGTGTGACAAAGCTATGAGG - Intergenic
1073409322 10:103326984-103327006 AAATGTCTGAAACAACTTTGAGG + Intronic
1073532798 10:104247679-104247701 AAATGTACGATACAGTTATGTGG + Intronic
1074237192 10:111597536-111597558 AAATGTATGCAAGAGCAATGAGG - Intergenic
1075555795 10:123430850-123430872 AAATGTATTACCCAGTTATATGG + Intergenic
1076235965 10:128864085-128864107 AAATGTTTGACCCAGCACTGTGG + Intergenic
1077895913 11:6453230-6453252 AGATGTTTGAGATAGCTATGCGG - Intronic
1079099732 11:17533673-17533695 CCATGGATGACACAGCCATGGGG - Intronic
1079654160 11:22967377-22967399 CAGTGTAGGACACAGCTATGAGG + Intergenic
1079869447 11:25779195-25779217 GAATGCATGCCACAGCTATCTGG - Intergenic
1080485948 11:32706589-32706611 AAATCAATGACACTGCTATGGGG + Intronic
1081018434 11:37911865-37911887 AAATGTATGAGAAAGCTAATAGG + Intergenic
1085139538 11:74128514-74128536 AAATGTATCAAACAGCTAAATGG - Intronic
1086065202 11:82736369-82736391 AAAAGTTTGGCTCAGCTATGTGG - Intergenic
1088178392 11:107080878-107080900 ATATATAGGACACAACTATGAGG - Intergenic
1088482935 11:110312886-110312908 AAATATATGACTCAGCTTTATGG - Intergenic
1092709723 12:11322901-11322923 AAATGTGTGCAACAGCTTTGGGG + Intergenic
1092713476 12:11363388-11363410 AAATGTGTGCAACAGCTTTGGGG + Intronic
1092717964 12:11411049-11411071 AAATGTTTGCAACAGCTTTGGGG + Intronic
1092838153 12:12511632-12511654 AAATGTATGATACAGTGATAAGG - Intronic
1098974029 12:76883609-76883631 AAATGGATTAAACAGCAATGGGG - Intergenic
1099301830 12:80905636-80905658 ACATGTATTTCAAAGCTATGGGG + Intronic
1100714663 12:97293382-97293404 AAATGAATGACACAGCAGGGAGG - Intergenic
1101678568 12:106942512-106942534 AAATGTAGGACACTAGTATGGGG + Intergenic
1102557363 12:113736090-113736112 AAATAAATGACACAGTTCTGGGG - Intergenic
1102593566 12:113975351-113975373 AAATGTATCATATAGCTATGCGG + Intergenic
1104209959 12:126679180-126679202 AAATGTATGAAACAGCTTCATGG + Intergenic
1106224785 13:27776844-27776866 AAATGAATGAAAGAGCTATGTGG + Intergenic
1107677096 13:42808749-42808771 AAACTTATGACACATCTCTGTGG + Intergenic
1110032062 13:70628472-70628494 AGAGGTATGACCCAACTATGTGG + Intergenic
1110683346 13:78342485-78342507 AAATGTATGCTAGAGCTTTGGGG - Intergenic
1114705010 14:24715765-24715787 AACTGTAAGAATCAGCTATGTGG - Intergenic
1115900238 14:38138977-38138999 AAATGTATGACCTGGCTTTGAGG - Intergenic
1117453441 14:55874444-55874466 ACATGTACTACACAGCTCTGAGG + Intergenic
1117662842 14:58026182-58026204 AAATATATGACACATAAATGAGG + Intronic
1120681218 14:87483004-87483026 AAATGTGTTAAACAGCTCTGTGG - Intergenic
1121897683 14:97663783-97663805 AAATGTAAGACATGGCAATGTGG - Intergenic
1122012649 14:98764255-98764277 AAAAATATTACACAGCTGTGGGG + Intergenic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1129567875 15:76643235-76643257 AAATGTTTGGCACAGGCATGTGG - Intronic
1130758368 15:86790797-86790819 AAATGTATAACAGTTCTATGTGG + Intronic
1130824568 15:87530845-87530867 ATATGTATGTTACTGCTATGTGG - Intergenic
1133046903 16:3093052-3093074 ACATGGATGACCCAGGTATGGGG - Intronic
1133963478 16:10514531-10514553 AACTGTATGACACTGCTCTCTGG - Intergenic
1136926088 16:34375772-34375794 AATTGTATAATACAGCTTTGTGG - Intergenic
1136978486 16:35036035-35036057 AATTGTATAATACAGCTTTGTGG + Intergenic
1140048989 16:71462764-71462786 CAATGTAAGTCACAGCTTTGTGG - Intronic
1140584160 16:76268962-76268984 ACATGTATTCCACAGCTATTGGG - Intergenic
1140883043 16:79216298-79216320 AGATGTATAACACATATATGTGG + Intergenic
1142176896 16:88649619-88649641 AAATAAATGAGACAGCCATGAGG + Intronic
1147352958 17:39866504-39866526 AAAAGTCTGACACAGCCAAGGGG + Intergenic
1148857128 17:50584874-50584896 AAAGGCATGAAACAGCCATGGGG + Intronic
1149159177 17:53669447-53669469 TAATGTATCACACAACTAAGAGG + Intergenic
1150571229 17:66388851-66388873 AAATGCAAGACACGGCTCTGCGG - Intronic
1155698038 18:28707384-28707406 AAATGTACCACACAACTGTGGGG - Intergenic
1157706117 18:49808323-49808345 ATATGTATGATACAGCAATCAGG + Intronic
1159091278 18:63852088-63852110 CAATGTATTACACAGCTTTTAGG + Intergenic
1162174222 19:8819020-8819042 AAATCTATCACACAGCTGAGTGG + Intronic
1165701744 19:37943423-37943445 AAATGTATGACACTGACATTTGG - Intronic
1168675268 19:58273284-58273306 ATATATATGAAACAGCTATTTGG + Intronic
933056256 2:77670774-77670796 AAAAGTATGACACAGTTACAGGG + Intergenic
933620499 2:84534161-84534183 AAATGTTTAACACAGCTATAAGG + Intronic
933927810 2:87115089-87115111 AAAAGTATGACACAGTTACAGGG + Intergenic
933942385 2:87255181-87255203 AAATGAATGACCAAGTTATGTGG + Intergenic
936337841 2:111606388-111606410 AAATGAATGACCAAGTTATGTGG - Intergenic
939025093 2:137003059-137003081 AAATGTTTGACATATCTCTGGGG + Intronic
939090691 2:137776774-137776796 AAATCCAGGACACAGCTATGGGG + Intergenic
940928166 2:159392104-159392126 CACTGTATGACACACCTGTGTGG + Intronic
941779530 2:169429036-169429058 TAATGTATGACCCAGCCATTGGG + Intergenic
941981493 2:171462893-171462915 AAATTTGTGATACAGCTATATGG - Intronic
942620711 2:177842747-177842769 AAATGTAAGCCACTGCTATCTGG - Intronic
943099218 2:183468080-183468102 AAAAGTCTGACACAGTAATGAGG - Intergenic
945085833 2:206131504-206131526 AAAAATATTACACAGCTGTGAGG + Intronic
945178037 2:207063323-207063345 AACTGTATGACACAGGAATTGGG - Intergenic
947055205 2:226092084-226092106 AGATGTGTGCCACAGCCATGGGG - Intergenic
947259879 2:228208985-228209007 AAATGTATTATACAGTTCTGGGG - Intergenic
947682767 2:232050843-232050865 AAACATATCACACAGCAATGTGG - Intronic
1168963868 20:1887157-1887179 ATAGGTATGGCACGGCTATGAGG + Intergenic
1169410428 20:5364574-5364596 AAATGTATGACAAAGCTTGGGGG + Intergenic
1169690864 20:8330099-8330121 AAATGTAGGACAAAACCATGGGG + Intronic
1171394164 20:24820328-24820350 AAATGTATTACTCAGTGATGAGG - Intergenic
1171565675 20:26183880-26183902 AAATGTAAGTAACTGCTATGTGG - Intergenic
1177662818 21:24109154-24109176 AAATATATTAAACAGCTATATGG - Intergenic
1178342628 21:31799227-31799249 AGAAGTGTGACACAGCTAAGTGG + Intergenic
1179362229 21:40721099-40721121 AAATGTATCACACAGCTGCAGGG + Intronic
1182747938 22:32620049-32620071 AAATCTATGAGTCAGCTAAGTGG - Intronic
949525532 3:4899702-4899724 ACATTTATGACACTCCTATGAGG + Intergenic
951272216 3:20640077-20640099 AAATGAATCACAGAACTATGAGG - Intergenic
952022240 3:29037671-29037693 AAAAACATGACTCAGCTATGTGG - Intergenic
952192462 3:31038240-31038262 AAATGTATGACACAGAAAGTAGG + Intergenic
952745640 3:36775196-36775218 ACATGTATGCCACAGGTATAAGG + Intergenic
953278440 3:41527980-41528002 AAATGTATGACACAGCTATGTGG + Intronic
956005147 3:64770773-64770795 AAATATAGGACACAGAGATGGGG - Intergenic
959231689 3:103662507-103662529 AAATGTATGTCACAGACGTGAGG + Intergenic
959314095 3:104779968-104779990 GAATGTATGAAAAAGCTATAGGG - Intergenic
959693688 3:109226673-109226695 AAATGTATGACACCGGGATCAGG - Intergenic
963531097 3:146474336-146474358 AAAGGTATAACACAGCTTTATGG + Intronic
963853042 3:150226678-150226700 AAAACCATGACCCAGCTATGAGG - Intergenic
964236237 3:154533025-154533047 ATTTGTTTTACACAGCTATGTGG - Intergenic
964821001 3:160769334-160769356 AAGTGTATAACACTGATATGGGG + Intronic
965714360 3:171586793-171586815 AAATGTCTACCACAGCTTTGGGG - Intergenic
971339585 4:25755598-25755620 AAATGTATGAAAGAACTATGGGG + Intronic
972029184 4:34431125-34431147 AAATGTAAGTAACTGCTATGTGG - Intergenic
976871711 4:89802104-89802126 AAATGTCTCACAATGCTATGTGG + Intronic
979554934 4:122034879-122034901 TAATGTGTGACATAGCTATGGGG - Intergenic
979954663 4:126937413-126937435 AAATGTATGTCATAACTGTGAGG + Intergenic
980950868 4:139375060-139375082 AAAGGCATGATACAGCTAGGTGG + Intronic
981471869 4:145144988-145145010 AAATGTTCCACACAGCTAAGAGG + Intronic
981557001 4:146006333-146006355 AAATGTCTGATACATCTATTTGG + Intergenic
981666819 4:147237443-147237465 AAATGTAAGAGACAGCTATGTGG - Intergenic
982628166 4:157794790-157794812 GAATGTATGAGACAAATATGGGG + Intergenic
986932623 5:12845764-12845786 AGATGTCTGCCACAGCAATGGGG - Intergenic
987444203 5:17996941-17996963 AGATGTATAACAAAGCTATGGGG - Intergenic
990853731 5:60239054-60239076 AAATGTATGAAATATCTTTGTGG - Intronic
992884782 5:81147609-81147631 AAATGTAACAAACAGCCATGGGG + Intronic
992951709 5:81864761-81864783 AAATATTTGACTCAGATATGAGG + Intergenic
993157654 5:84246440-84246462 AAGTGTGTGAGACAGCTAAGTGG - Intronic
993206384 5:84885653-84885675 AACTCTATTACACAGCTATCTGG + Intergenic
993520254 5:88890873-88890895 AAATTTATGACATAACTTTGGGG - Intronic
995763840 5:115594449-115594471 AAATGTATAACTCTGCTATTTGG - Intronic
998179026 5:139923503-139923525 AAATGTCTGAGACAGATCTGAGG - Intronic
998185350 5:139975044-139975066 ACATGTACGACACACATATGAGG - Intronic
998672868 5:144373294-144373316 AAATGAAGGACCCTGCTATGAGG + Intronic
1000512624 5:162202852-162202874 AAAAGGATGAGACAGTTATGGGG - Intergenic
1001139705 5:169134472-169134494 AAAAGAATGAGGCAGCTATGGGG - Intronic
1001439676 5:171732683-171732705 AAATGAATGACAAAGCAAAGGGG + Intergenic
1003622430 6:7712758-7712780 AAATGCATGAGCCAGCCATGGGG - Intergenic
1005795340 6:29354855-29354877 AAAAATATGACACACATATGAGG + Intergenic
1007214008 6:40221840-40221862 AAAGACATGACACAGCTATAAGG + Intergenic
1007540399 6:42637645-42637667 AAATATATGAAACAGCTCAGAGG - Intronic
1007753979 6:44086987-44087009 CATTGTAGGACACAGCCATGGGG + Intergenic
1008215952 6:48789124-48789146 TAATGTATGATGAAGCTATGTGG - Intergenic
1008586289 6:52953260-52953282 ACATCTATGGCCCAGCTATGCGG + Intergenic
1011529684 6:88307959-88307981 ATGTGTATGATACAGCTAAGAGG - Intergenic
1011853042 6:91654322-91654344 CAATGTATGACATAGCTAGTAGG - Intergenic
1012905459 6:105059708-105059730 AAATGTATGACAATACTATTTGG + Intronic
1016523993 6:144978740-144978762 ATATTTATGGCACTGCTATGTGG - Intergenic
1016795805 6:148115967-148115989 AATTGGCTCACACAGCTATGTGG + Intergenic
1018762601 6:166904810-166904832 AAATGAATGTCAGAGCCATGCGG + Intronic
1018780578 6:167060221-167060243 ACATGTATGACACCAATATGTGG - Intergenic
1021047028 7:15936073-15936095 ACATGTTTAAAACAGCTATGTGG + Intergenic
1021324501 7:19249131-19249153 AAATGTATAACACACCCAGGTGG + Intergenic
1023292389 7:38681909-38681931 AGATGGAAGACACAGCTATCTGG - Intergenic
1024595805 7:50936289-50936311 AAATGTATGAAACAATTTTGTGG - Intergenic
1024844234 7:53622994-53623016 AAATGTTAGAGGCAGCTATGAGG + Intergenic
1026040474 7:66864278-66864300 AAATGTATGCCAAAGAAATGGGG - Intergenic
1027879172 7:83811528-83811550 AAATACATCACACAGATATGTGG + Intergenic
1028914885 7:96247823-96247845 AACTATATGAGACAACTATGTGG - Intronic
1031457999 7:122008238-122008260 AAATGGATGACATATCTTTGGGG + Intronic
1034322164 7:150196204-150196226 AAAAGTATGACAAAGATTTGAGG - Intergenic
1035145872 7:156815557-156815579 AACTGTATGATACAGGGATGTGG - Intronic
1035998926 8:4580117-4580139 AAATGTATTAAACACCTATGTGG + Intronic
1037105362 8:15100397-15100419 ATATGTATGAAACAGATATGAGG + Intronic
1038136143 8:24788103-24788125 AAATATATGAAATAGATATGTGG - Intergenic
1038142136 8:24857435-24857457 AAATGTATAACACAGTGTTGAGG + Intergenic
1038981369 8:32763157-32763179 AAATGTATGACACTGTTGTCAGG + Intronic
1040129210 8:43774829-43774851 AAATCTATGAAACTGCTTTGTGG + Intergenic
1040611705 8:48990847-48990869 AAATGTATGGTACAGATATTGGG + Intergenic
1040632917 8:49237334-49237356 CAATCTATGACACTGTTATGAGG - Intergenic
1041783161 8:61600812-61600834 AAAAGTAAGAGCCAGCTATGTGG + Intronic
1043440788 8:80275558-80275580 AAAAGAAAGACACAGCTTTGGGG - Intergenic
1045068049 8:98469826-98469848 AAAGTAATAACACAGCTATGTGG + Intronic
1046321407 8:112581914-112581936 AAATGAGGGACACAGCCATGTGG + Intronic
1049126962 8:140799340-140799362 AATTGTATTAAACAGCGATGAGG - Intronic
1050716986 9:8541116-8541138 GAATGTATTACAGATCTATGGGG + Intronic
1055742602 9:79406512-79406534 AAATGTATGATAGAAATATGAGG + Intergenic
1056434050 9:86558068-86558090 AAATCTATGCCAGAGCTCTGTGG - Intergenic
1059125315 9:111679185-111679207 AAATGCATGACATAACTAAGAGG + Intergenic
1203457075 Un_GL000219v1:178268-178290 AAATCCAGGACACTGCTATGAGG - Intergenic
1190976378 X:55405797-55405819 AAGAGTAAGACACAGCTATCGGG + Intergenic
1193958582 X:87894856-87894878 AAATGTATGACACAGTCAGGTGG - Intergenic