ID: 953280265

View in Genome Browser
Species Human (GRCh38)
Location 3:41548048-41548070
Sequence GGGTTGGTATCCTAAAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 388}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953280265_953280272 -7 Left 953280265 3:41548048-41548070 CCAGCCCTTTAGGATACCAACCC 0: 1
1: 0
2: 2
3: 7
4: 388
Right 953280272 3:41548064-41548086 CCAACCCAGGACTTGAGGATGGG 0: 1
1: 0
2: 0
3: 17
4: 166
953280265_953280270 -8 Left 953280265 3:41548048-41548070 CCAGCCCTTTAGGATACCAACCC 0: 1
1: 0
2: 2
3: 7
4: 388
Right 953280270 3:41548063-41548085 ACCAACCCAGGACTTGAGGATGG 0: 1
1: 0
2: 3
3: 16
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953280265 Original CRISPR GGGTTGGTATCCTAAAGGGC TGG (reversed) Intronic
900672051 1:3860476-3860498 GCCTTGGTCTCCTAAAGTGCTGG + Intronic
900883729 1:5401129-5401151 GGGTTAGTGGCCTAGAGGGCTGG - Intergenic
901275135 1:7985535-7985557 GGCTCGGTTTCCTAAAGTGCTGG - Intergenic
901372595 1:8812395-8812417 GCCTTGGCTTCCTAAAGGGCCGG - Intronic
902231544 1:15030753-15030775 GGGCTGGAACCTTAAAGGGCTGG - Intronic
903901140 1:26646452-26646474 GGCTTGGCCTCCCAAAGGGCTGG - Intergenic
904181762 1:28670720-28670742 GCGTTGGCCTCCTAAAGTGCTGG + Intronic
904522406 1:31105750-31105772 GCCTTGGTTTCCTAAAGTGCTGG - Intergenic
905092224 1:35438740-35438762 GCCTTGGTCTCCTAAAGTGCTGG - Intronic
906218683 1:44060218-44060240 GGCTTGGCCTCCTAAAGTGCTGG - Intergenic
906511875 1:46414616-46414638 GGGTGGGTTTGCTAAATGGCAGG + Intergenic
907116659 1:51974962-51974984 GTGTTGGTTTCCCAAAGTGCTGG - Intronic
907449420 1:54533938-54533960 GCCTTGGTCTCCTAAAGTGCTGG - Intergenic
907778369 1:57541376-57541398 GCCTTGGTCTCCCAAAGGGCTGG + Intronic
908287478 1:62623021-62623043 GCCTTGGCCTCCTAAAGGGCTGG + Intronic
908841711 1:68286528-68286550 GTCTTGGTCTCCTAAAGTGCTGG + Intergenic
909042343 1:70669489-70669511 GCGTTGGCCTCCCAAAGGGCTGG + Intergenic
909276594 1:73694849-73694871 GCCTTGGCCTCCTAAAGGGCTGG + Intergenic
910835613 1:91506247-91506269 GCCTTGGTCTCCTAAAGTGCTGG + Intronic
911209366 1:95123056-95123078 GCCTTGGTATCCCAAAGTGCTGG + Intronic
913266792 1:117053064-117053086 GCGTTGGCCTCCCAAAGGGCTGG - Intergenic
913678961 1:121170323-121170345 GGGTGGGTATCCTGAATTGCTGG - Intronic
914030793 1:143957969-143957991 GGGTGGGTATCCTGAATTGCTGG - Intronic
914158656 1:145109993-145110015 GGGTGGGTATCCTGAATTGCTGG + Intronic
914201973 1:145493203-145493225 GCCTTGGTATCCCAAAGTGCTGG + Intergenic
914235901 1:145811117-145811139 GCCTTGGTATCCCAAAGTGCTGG + Intronic
914481095 1:148066331-148066353 GCCTTGGTATCCCAAAGTGCTGG + Intergenic
915104442 1:153524459-153524481 GGCTTGGCATCCCAAAGTGCTGG - Intergenic
915353673 1:155242469-155242491 GCCTTGGTATCCGAAAGTGCTGG + Intronic
917968719 1:180194164-180194186 GGGCTGGCAGCCTGAAGGGCTGG + Intronic
920466260 1:206188861-206188883 GGGTGGGTATCCTGAATTGCTGG - Intronic
920527634 1:206679477-206679499 GCCTTGGTCTCCTAAAGTGCTGG - Intronic
920632390 1:207665301-207665323 GCCTTGGTATCCCAAAGTGCTGG + Intronic
922412480 1:225389954-225389976 GTGTTGTCATCCTAAAGGGGAGG - Intronic
923612669 1:235509248-235509270 GCGTTGGCATCCCAAAGTGCTGG + Intergenic
1066050817 10:31633247-31633269 GGGTTAGTATCCTAGTAGGCTGG - Intergenic
1066602378 10:37123512-37123534 GGCTTGGCCTCCTAAAGTGCTGG + Intergenic
1066675247 10:37880805-37880827 GGGTTGGCCTCCCAAAGTGCTGG + Intergenic
1067121729 10:43478168-43478190 GGGTTGGTCTCCCGAAGTGCTGG - Intronic
1067396393 10:45923724-45923746 GGCTTGGCCTCCTAAAGTGCTGG - Intergenic
1067864713 10:49892830-49892852 GGCTTGGCCTCCTAAAGTGCTGG - Intronic
1072355507 10:94605879-94605901 GGCTTGGCCTCCCAAAGGGCTGG + Intronic
1072676166 10:97467915-97467937 GCCTTGGTCTCCTAAAGTGCTGG + Intronic
1073021911 10:100452150-100452172 GCGTTGGCCTCCTAAAGTGCTGG + Intergenic
1073350655 10:102817402-102817424 GGCTTGGTTTCCCAAAGTGCTGG + Intergenic
1073502674 10:103955595-103955617 GCCTTGGTATCCCAAAGTGCTGG - Intergenic
1073780275 10:106830644-106830666 GTCTTGGTTTCCTAAAGTGCTGG - Intronic
1074073894 10:110102357-110102379 GCCTTGGCATCCTAAAGTGCTGG - Intronic
1076488360 10:130839051-130839073 GCCTTGGTCTCCTAAAGTGCTGG - Intergenic
1077017896 11:404989-405011 GGGTGGGTGTCCTCAGGGGCAGG - Intergenic
1077655373 11:4013954-4013976 GTGTTGGTTTCCCAAAGTGCTGG + Intronic
1080274909 11:30493078-30493100 GAGTTGGTATCCAGAAGGACTGG - Intronic
1081686315 11:45045679-45045701 GCCTTGGTCTCCTAAAGTGCTGG + Intergenic
1083284892 11:61652032-61652054 GGGATGGTTTCCTGAAGGACTGG - Intergenic
1084124928 11:67093174-67093196 GCCTTGGCATCCTAAAGTGCTGG - Intergenic
1084269268 11:68020482-68020504 GCCTTGGTCTCCTAAAGTGCAGG + Intronic
1086342901 11:85865636-85865658 GCTTTGGTCTCCCAAAGGGCTGG - Intronic
1087530499 11:99375051-99375073 GCCTTGGCATCCCAAAGGGCTGG - Intronic
1088299785 11:108344752-108344774 GCCTTGGTATCCTTAAGTGCTGG - Intronic
1092080194 12:5709637-5709659 GGTATGGTAACCTAAAGAGCTGG - Intronic
1092624914 12:10316650-10316672 GCCTTGGCCTCCTAAAGGGCTGG + Intergenic
1092683748 12:11017740-11017762 GCGTTGGTCTCCCAAAGTGCTGG + Intronic
1093060312 12:14595343-14595365 GCCTTGGTCTCCTAAAGTGCTGG + Intergenic
1093682287 12:22016500-22016522 GCCTTGGCATCCCAAAGGGCTGG - Intergenic
1093972561 12:25388632-25388654 GCTTTGGTATTCTACAGGGCTGG + Intergenic
1094193287 12:27718835-27718857 GCCTTGGTATCCCAAAGTGCTGG - Intronic
1096362176 12:50997450-50997472 GCCTTGGTCTCCTAAAGTGCTGG - Intronic
1096989989 12:55792932-55792954 GGCTTGGCATCCCAAAGTGCTGG + Intronic
1097882707 12:64700510-64700532 GCTTTGGCCTCCTAAAGGGCTGG + Intergenic
1100985774 12:100200306-100200328 GCCTTGGTCTCCTAAAGTGCTGG + Exonic
1101242469 12:102851903-102851925 AGGTTGGGATCATAAAAGGCAGG + Intronic
1102749600 12:115280878-115280900 GCCTTGGTCTCCTAAAGTGCTGG - Intergenic
1103063037 12:117874480-117874502 GCCTTGGTCTCCTAAAGTGCTGG + Intronic
1103399740 12:120635532-120635554 GCCTTGGCATCCTAAAGTGCTGG + Intergenic
1103687912 12:122746852-122746874 GCCTTGGTATCCCAAAGTGCTGG - Intergenic
1104398917 12:128459640-128459662 GCCTTGGTCTCCTAAAGTGCTGG - Intronic
1104697570 12:130875073-130875095 GCCTTGGCCTCCTAAAGGGCTGG + Intronic
1105058219 12:133123473-133123495 GCGTTGGTCTCCCAAAGTGCTGG - Intronic
1105325579 13:19367927-19367949 GCCTTGGTATCCCAAAGTGCTGG + Intergenic
1105607998 13:21943139-21943161 GGGTTGGTTGCCTTAATGGCAGG - Intergenic
1106037741 13:26059635-26059657 TGTGTGGTATCCAAAAGGGCAGG + Intergenic
1107922416 13:45222904-45222926 GCTTTGGTCTCCCAAAGGGCTGG - Intronic
1111885336 13:94013597-94013619 GGCTTGGCCTCCCAAAGGGCTGG + Intronic
1111913905 13:94341333-94341355 GCTTTGGTATCCCAAAGTGCTGG - Intronic
1112024902 13:95403099-95403121 CGCTTGGCCTCCTAAAGGGCTGG + Intergenic
1112259549 13:97865406-97865428 GCCTTGGCCTCCTAAAGGGCTGG + Intergenic
1114257994 14:21018706-21018728 GGGTTGGGGTCCTAAAGTGGTGG - Intronic
1115058425 14:29159688-29159710 GCCTTGGTGTCCTAAAGCGCTGG + Intergenic
1116783021 14:49257199-49257221 GCCTTGGTCTCCTAAAGTGCTGG - Intergenic
1117398944 14:55340494-55340516 GCCTTGGTATCCCAAAGTGCTGG + Intronic
1117674333 14:58140649-58140671 GCCTTGGTATCCCAAAGTGCTGG - Intronic
1118127225 14:62920137-62920159 GAGTTGGTATCCTAAAGTGCTGG - Intronic
1119282393 14:73420568-73420590 GCGTTGGCATCCCAAAGTGCTGG - Intronic
1119403904 14:74383777-74383799 GCCTTGGTCTCCTAAAGTGCTGG - Intergenic
1119631798 14:76238454-76238476 GCGTTGGCCTCCCAAAGGGCTGG + Intronic
1119754331 14:77104109-77104131 GGCTTGGCATCCCAAAGTGCTGG - Intronic
1119938984 14:78620164-78620186 GGGTTGGTATACTAATGGTAGGG + Intronic
1120202894 14:81556893-81556915 GGCTTGGTATCCCAAAGCACTGG + Intergenic
1120532592 14:85650961-85650983 GCCTTGGTTTCCTAAAGTGCTGG + Exonic
1120655810 14:87188710-87188732 GCCTTGGCCTCCTAAAGGGCTGG - Intergenic
1122730702 14:103795185-103795207 GCCTTGGCCTCCTAAAGGGCTGG + Intronic
1122756079 14:103981154-103981176 GCTTTGGTCTCCTAAAGTGCTGG + Intronic
1122766214 14:104072511-104072533 GCGTTGGTCTCCCAAAGTGCTGG + Intergenic
1123625306 15:22223174-22223196 GGGTTGGCATCCCACAGTGCTGG + Intergenic
1124089637 15:26586244-26586266 GCCTTGGTCTCCTAAAGTGCTGG + Intronic
1124446141 15:29734733-29734755 GCTTTGGTCTCCTAAAGTGCTGG + Intronic
1125810959 15:42540776-42540798 GCCTTGGTCTCCCAAAGGGCTGG - Exonic
1125986888 15:44062439-44062461 GCCTTGGTCTCCTAAAGTGCTGG - Intronic
1126596389 15:50388072-50388094 GCGTTGGTCTCCCAAAGTGCTGG - Intergenic
1127211939 15:56782293-56782315 GCCTTGGTATCCCAAAGCGCTGG + Intronic
1127693544 15:61421475-61421497 GTGTTGGTGTCCTCCAGGGCAGG + Intergenic
1127989302 15:64099959-64099981 GCCTTGGTATCCCAAAGTGCTGG + Intronic
1128051093 15:64665500-64665522 GCCTTGGTTTCCTAAAGAGCTGG - Intronic
1128575374 15:68770772-68770794 GCCTTGGTCTCCTAAAGTGCTGG - Intergenic
1128635741 15:69301251-69301273 GGGTTGGCCTCCCAAAGTGCTGG + Intronic
1128645104 15:69372292-69372314 GTGTTGGTTTCCCAAAGTGCTGG - Intronic
1129233350 15:74208938-74208960 GGGCTGGGATCCTAGAGGGGTGG + Intronic
1129368905 15:75075185-75075207 GCCTTGGTATCCCAAAGTGCTGG - Intronic
1129375860 15:75130922-75130944 GGCTTGGTCTCCCAAAGTGCTGG + Intergenic
1129930209 15:79404276-79404298 TGGTTGGTCTTCTTAAGGGCTGG + Intronic
1130023997 15:80255289-80255311 GGCTTGGCCTCCCAAAGGGCTGG + Intergenic
1130136940 15:81189371-81189393 GCCTTGGTCTCCTAAAGTGCTGG + Intronic
1131702198 15:94950210-94950232 GGTTTGGCCTCCTAAAGAGCTGG + Intergenic
1132225486 15:100137760-100137782 GGGTGGGTTCCCCAAAGGGCAGG + Intronic
1132916867 16:2353629-2353651 GGCTTGGCCTCCTAAAGTGCTGG + Intergenic
1133094101 16:3429220-3429242 GCCTTGGTCTCCCAAAGGGCTGG + Intronic
1133437344 16:5791115-5791137 GCGTTGGTCTCCTAAAGTGCTGG + Intergenic
1133997021 16:10756127-10756149 GGCTTGGCCTCCTAAAGTGCTGG - Intronic
1134041108 16:11069080-11069102 GCCTTGGTATCCCAAAGTGCTGG + Intronic
1134447310 16:14340651-14340673 GCCTTGGTCTCCCAAAGGGCTGG + Intergenic
1134527645 16:14956691-14956713 GCCTTGGCCTCCTAAAGGGCTGG - Intergenic
1135650790 16:24204742-24204764 TGGTTTGTATCCTAGATGGCTGG - Intronic
1136315495 16:29452612-29452634 GCCTTGGTCTCCTAAAGTGCTGG - Intronic
1136430072 16:30191954-30191976 GCCTTGGTCTCCTAAAGTGCTGG - Intergenic
1136994068 16:35176080-35176102 GCCTTGGTCTCCTAAAGTGCTGG + Intergenic
1138481678 16:57307448-57307470 GGGTTGTTATCCCAATGGGGAGG - Intergenic
1139624084 16:68171256-68171278 GCCTTGGTCTCCTAAAGTGCTGG + Intronic
1139683288 16:68581914-68581936 GCGTTGGCCTCCCAAAGGGCTGG - Intergenic
1139812202 16:69630279-69630301 GGCTTGGCCTCCTAAAGTGCTGG + Intronic
1140558838 16:75953894-75953916 GCCTTGGTCTCCTAAAGTGCTGG + Intergenic
1141059697 16:80854406-80854428 GTCTTGGTCTCCTAAAGTGCTGG - Intergenic
1142778399 17:2160578-2160600 GCCTTGGCATCCTAAAGTGCTGG - Intronic
1142792378 17:2277413-2277435 GCGTTGGCCTCCTAAAGAGCTGG + Intronic
1144380680 17:14694742-14694764 GCCTTGGTCTCCTAAAGTGCTGG - Intergenic
1145857737 17:28178362-28178384 GGGGTGGTTCCCTAAAGGTCAGG + Intronic
1147972852 17:44229101-44229123 GGCTTGGTCTCCCAAAGTGCTGG + Intergenic
1148085063 17:44988802-44988824 GGCTTGGCCTCCTAAAGTGCTGG - Intergenic
1148174966 17:45556195-45556217 GCCTTGGCATCCTAAAGTGCTGG - Intergenic
1148296405 17:46506832-46506854 GCCTTGGCATCCTAAAGTGCTGG + Intergenic
1148454366 17:47802973-47802995 GCGTTGGCCTCCTAAAGTGCTGG - Intergenic
1149698819 17:58638257-58638279 GGGTTGGCCTCCCAAAGTGCTGG - Intronic
1150406184 17:64903106-64903128 GCCTTGGCATCCTAAAGTGCTGG - Intronic
1150816375 17:68395336-68395358 GCCTTGGTCTCCTAAAGTGCTGG - Intronic
1151318750 17:73339804-73339826 GCCTTGGTCTCCTAAAGTGCTGG + Intronic
1152694711 17:81738389-81738411 GACTTGGTGTCCTAAGGGGCAGG - Intergenic
1154207468 18:12349909-12349931 GCCTTGGTATCCCAAAGTGCTGG + Intronic
1154345660 18:13541801-13541823 GGCTTGGTCTCCCAAAGTGCTGG - Intronic
1156328065 18:36092465-36092487 GCTTTGGTCTCCTAAAGTGCTGG + Intergenic
1157355761 18:46932423-46932445 GCCTTGGTCTCCTAAAGTGCTGG - Intronic
1159092790 18:63868711-63868733 GCTTTGGCATCCTAAAGGGCTGG - Intergenic
1159455997 18:68660799-68660821 GGATTTATATCCTAAAGGGTTGG + Intergenic
1159592630 18:70351603-70351625 GGCCTGGGATCCCAAAGGGCTGG - Intronic
1161108925 19:2457931-2457953 GGCTTGGCCTCCTAAAGTGCTGG - Intergenic
1162360401 19:10216569-10216591 GCATTGGTCTCCCAAAGGGCTGG + Intronic
1162637795 19:11984130-11984152 GCTTTGGTCTCCCAAAGGGCTGG - Intergenic
1163693093 19:18747826-18747848 GCGTTGGTCTCCAAAAGTGCTGG - Intronic
1164018737 19:21277236-21277258 GTCTTGGTCTCCCAAAGGGCTGG + Intronic
1164374111 19:27670783-27670805 GGCTTGGTCTCCAAAAGTGCTGG - Intergenic
1164903753 19:31949917-31949939 GCCTTGGTATCCCAAAGTGCTGG - Intergenic
1166701377 19:44883868-44883890 GGGTTGGCTTCCCAAAGTGCTGG - Intronic
1167701452 19:51049595-51049617 GCCTTGGCATCCTAAAGTGCTGG - Intergenic
1168542736 19:57226515-57226537 GCCTTGGCCTCCTAAAGGGCTGG + Intergenic
925769569 2:7268725-7268747 CCGTTGGTATCCCAAAGTGCTGG + Intergenic
925904150 2:8529362-8529384 GCTTTGGTATCTTAAAGGCCTGG + Intergenic
926031327 2:9592474-9592496 GCCTTGGCATCCTAAAGTGCTGG - Intronic
926967569 2:18431923-18431945 GCCTTGGTCTCCTAAAGTGCTGG + Intergenic
927821696 2:26271679-26271701 GCCTTGGTTTCCTAAAGTGCTGG - Intronic
928226508 2:29453483-29453505 GCCTTGGTCTCCTAAAGTGCTGG + Intronic
928676116 2:33653687-33653709 GCCTTGGCATCCTAAAGTGCTGG + Intergenic
929523321 2:42675381-42675403 GCGTTGGCCTCCTAAAGTGCAGG + Intronic
930831527 2:55748929-55748951 GCCTTGGCATCCTAAAGTGCTGG - Intergenic
931306181 2:61031038-61031060 GCCTTGGTTTCCTAAAGTGCTGG - Intronic
931367806 2:61634642-61634664 GCCTTGGTATCCCAAAGTGCTGG + Intergenic
932189053 2:69723797-69723819 ACGTTGGTCTCCTAAAGTGCTGG + Intronic
933081020 2:77986001-77986023 GCCTTGGTCTCCCAAAGGGCTGG + Intergenic
933616014 2:84483211-84483233 GTGTTGGCATCCCAAAGTGCTGG + Intergenic
934589778 2:95536800-95536822 GCCTTGGTATCCCAAAGTGCTGG - Intergenic
935610997 2:105025464-105025486 GCCTTGGTATCCCAAAGTGCTGG - Intergenic
937687438 2:124713623-124713645 GCATTGGTTTCCTAAAGTGCTGG + Intronic
937944995 2:127325427-127325449 GCCTTGGTCTCCTAAAGCGCTGG - Intronic
938885541 2:135644251-135644273 GCCTTGGTCTCCTAAAGTGCTGG - Intronic
939524464 2:143275620-143275642 GGGTTGGTAACCTAAAGAGCAGG - Intronic
940532570 2:154897993-154898015 GCCTTGGTCTCCTAAAGTGCTGG - Intergenic
940655836 2:156487054-156487076 GCCTTGGCATCCTAAAGTGCTGG - Intronic
942170561 2:173285394-173285416 GCCTTGGTCTCCTAAAGTGCTGG - Intergenic
943363959 2:186951706-186951728 CGGTTGGCTTCCTAAAGTGCTGG + Intergenic
944189959 2:196992268-196992290 GGAATGATGTCCTAAAGGGCAGG - Intronic
945073429 2:206013907-206013929 GGCTTGGTCTCCCAAAGTGCTGG - Intronic
945513259 2:210729027-210729049 GGTCTGGAATCCTATAGGGCTGG - Intergenic
947160611 2:227210339-227210361 GCGTTGGCATCCCAAAGTGCTGG - Intronic
948277868 2:236723897-236723919 GTGTTGGCCTCCTGAAGGGCTGG + Intergenic
1169573884 20:6936795-6936817 GGCTTGGTCTCCCAAAGTGCTGG + Intergenic
1169968228 20:11240641-11240663 TGCTTTGTATCCTAAAGGTCTGG + Intergenic
1170847153 20:19971989-19972011 GCTTTGGTATCCCAAAGTGCTGG + Intronic
1171222649 20:23414071-23414093 TGGTTGGTCTCCCACAGGGCTGG - Intronic
1172199347 20:33114288-33114310 GGCTTGGTCTCCCAAAGTGCTGG - Intergenic
1172570834 20:35968965-35968987 GGGCTGGTAGGCTACAGGGCAGG - Intronic
1172651154 20:36502599-36502621 GGGTTGGCCTCCCAAAGTGCTGG + Intronic
1172730823 20:37085896-37085918 GGCTTGGTCTCCCAAAGTGCTGG + Intronic
1173372856 20:42453946-42453968 GTGTTGGCCTCCTAAAGTGCTGG + Intronic
1175897234 20:62343893-62343915 GCCTTGGCATCCTAAAGTGCTGG - Intronic
1176729604 21:10480135-10480157 GGCTTGGCATCCCAAAGTGCTGG - Intergenic
1176925864 21:14748127-14748149 GCCTTGGTCTCCTAAAGTGCTGG - Intergenic
1177193496 21:17878192-17878214 GCCTTGGTATCCCAAAGCGCTGG - Intergenic
1177829387 21:26120402-26120424 GCCTTGGTCTCCTAAAGTGCTGG + Intronic
1178807130 21:35848560-35848582 GCTTTGGTCTCCTAAAGTGCTGG + Intronic
1178985759 21:37301503-37301525 GCCTTGGTCTCCTAAAGAGCTGG + Intergenic
1179707480 21:43190538-43190560 GGCTTGGTCTCCCAAAGTGCTGG + Intergenic
1180355875 22:11839360-11839382 GCCTTGGTCTCCTAAAGTGCTGG + Intergenic
1180382381 22:12152965-12152987 GCCTTGGTCTCCTAAAGTGCTGG - Intergenic
1182476197 22:30577743-30577765 GTCTTGGTATCCCAAAGTGCTGG + Intronic
1182689156 22:32144474-32144496 GGGTTTGTGTGCAAAAGGGCTGG - Intergenic
1184127371 22:42497174-42497196 GCCTTGGTCTCCTAAAGTGCTGG - Intergenic
1185292075 22:50032216-50032238 GGGTTGGAGTCCTCAGGGGCAGG - Intronic
949917183 3:8974216-8974238 GGCTTGGTCTCCCAAAGTGCTGG + Intergenic
950047576 3:9958955-9958977 GCCTTGGTCTCCTAAAGTGCTGG + Intergenic
950942041 3:16902575-16902597 GCCTTGGCATCCTAAAGTGCTGG - Intronic
951134266 3:19084903-19084925 GCCTTTGTATCCTAAAGTGCTGG - Intergenic
951519547 3:23598668-23598690 GCCTTGGCCTCCTAAAGGGCTGG - Intergenic
952292960 3:32036295-32036317 GCGTTGGTTTCCAAAAGTGCTGG + Intronic
953280265 3:41548048-41548070 GGGTTGGTATCCTAAAGGGCTGG - Intronic
953603425 3:44390366-44390388 GCGTTGGCATCCCAAAGTGCTGG - Intronic
953802669 3:46038265-46038287 GGCTTGGTCTCCCAAAGTGCTGG + Intergenic
954000930 3:47556428-47556450 GGCTTGGTCTCCCAAAGTGCTGG + Intergenic
955717372 3:61844750-61844772 GCCTTGGTCTCCTAAAGTGCTGG + Intronic
956457552 3:69438353-69438375 GCCTTGGCATCCTAAAGTGCTGG + Intronic
961416463 3:126761674-126761696 GCCTTGGCCTCCTAAAGGGCTGG + Intronic
963145328 3:141988193-141988215 GGGTTGGCCTCCCAAAGTGCTGG + Intronic
963894968 3:150675596-150675618 GCTTTGGTCTCCTAGAGGGCTGG + Intronic
966358321 3:179106221-179106243 GCCTTGGTCTCCTAAAGTGCTGG - Intergenic
968048798 3:195639545-195639567 AGGCTGGCATCCTGAAGGGCGGG - Intergenic
968098603 3:195950082-195950104 AGGCTGGCATCCTGAAGGGCGGG + Intergenic
968305819 3:197650379-197650401 AGGCTGGCATCCTGAAGGGCGGG + Intergenic
968426483 4:526795-526817 GCATTGGCATCCTAAAGTGCTGG + Intronic
968719460 4:2189779-2189801 GCCTTGGTCTCCTAAAGTGCTGG - Intronic
969395155 4:6915809-6915831 GGGTTCTTATCCTAAGGGTCAGG - Intronic
970067124 4:12110746-12110768 GGGTTAGTTTCCTACAAGGCAGG + Intergenic
970172533 4:13304133-13304155 GCGTTGGCATCCCAAAGTGCTGG - Intergenic
970483088 4:16497380-16497402 GGGTTTCTATACTAAAAGGCAGG + Intergenic
971432987 4:26588272-26588294 GCCTTGGCCTCCTAAAGGGCTGG + Intronic
971494124 4:27246252-27246274 GTCTTGGTCTCCTAAAGTGCCGG + Intergenic
972792191 4:42383758-42383780 GCGTTGGTCTCCCAAAGTGCTGG + Intergenic
975107961 4:70590702-70590724 GTGTTGGCATCCCAAAGTGCTGG - Intergenic
975493647 4:75014680-75014702 AGGTTGGCCTCCTAGAGGGCTGG + Intronic
976583086 4:86762970-86762992 GGTTTGGTCACCTAAATGGCTGG - Exonic
976605961 4:86983139-86983161 GCCTTGGTCTCCTAAAGTGCTGG - Intronic
977244461 4:94614362-94614384 GTCTTGGTCTCCTAAAGTGCTGG + Intronic
977958345 4:103056051-103056073 GGCTTGGTCTCCCAAAGTGCTGG + Intronic
978397947 4:108302433-108302455 GCCTTGGCATCCTAAAGTGCTGG - Intergenic
979263773 4:118678052-118678074 GCCTTGGTCTCCTAAAGTGCTGG - Intergenic
979463774 4:121012873-121012895 ACCTTGGCATCCTAAAGGGCTGG + Intergenic
979536900 4:121832091-121832113 GCGTTGGCCTCCTAAAGTGCTGG - Intronic
980949715 4:139362542-139362564 GGATTGGCCTCCTAAAGTGCTGG + Intronic
981738026 4:147973002-147973024 GCCTTGGTTTCCTAAAGTGCTGG + Intronic
982007001 4:151073120-151073142 GCCTTGGCCTCCTAAAGGGCTGG - Intergenic
982568264 4:157014869-157014891 GAGTTGGTATCGTATAGGGAAGG + Intergenic
982671230 4:158322087-158322109 GTGATGGTATCATAAAGGGATGG - Intronic
985505278 5:276024-276046 AGGCTGGCATCCTGAAGGGCGGG - Intronic
985667463 5:1188756-1188778 GCCTTGGTCTCCCAAAGGGCTGG - Intergenic
985742849 5:1629596-1629618 AGGCTGGCATCCTGAAGGGCGGG + Intergenic
985742985 5:1630532-1630554 GGCTTTGCATCCTGAAGGGCGGG + Intergenic
986684459 5:10264021-10264043 GGCTTGGCCTCCTAAAGTGCTGG - Intronic
986873201 5:12075088-12075110 GCCTTGGTATCCTAGAGTGCGGG + Intergenic
987344446 5:16966712-16966734 GCTTTGGCATCCTAAAGCGCTGG + Intergenic
988068976 5:26262736-26262758 GGGTTTTTATCATAAAGGGATGG + Intergenic
988388774 5:30600101-30600123 GCCTTGGTCTCCCAAAGGGCTGG + Intergenic
988802218 5:34707215-34707237 GCCTTGGTATCCCAAAGTGCTGG - Intronic
989737222 5:44722761-44722783 GGCTTGGGCTCCTAAAGTGCTGG - Intergenic
990990398 5:61678210-61678232 GCCTTGGTCTCCTAAAGTGCTGG + Intronic
991391474 5:66148709-66148731 GCTTTGGCATCCTAAAGTGCTGG + Intronic
991425363 5:66486429-66486451 GGCTTGGTCTCCCAAAGTGCTGG - Intergenic
992505728 5:77386034-77386056 GCCTTGGCATCCCAAAGGGCTGG + Intronic
994077106 5:95665723-95665745 GCCTTGGTCTCCCAAAGGGCTGG - Intronic
995160765 5:108978093-108978115 GCCTTGGTCTCCTAAAGTGCTGG + Intronic
995536032 5:113137395-113137417 GGGTTTTTATCATAAAGGGATGG + Intronic
996522052 5:124438194-124438216 GGGTTGGGATGCTACAGGACAGG - Intergenic
997543418 5:134684053-134684075 GGCTTGGCATCCCAAAGTGCTGG - Intronic
998029830 5:138856589-138856611 GTGTTGGACTCCCAAAGGGCTGG + Intronic
998209900 5:140187615-140187637 GCCTTGGTCTCCCAAAGGGCCGG + Intronic
999121484 5:149212873-149212895 GTGTTGGCATCCCAAAGTGCTGG - Intronic
999783820 5:154873153-154873175 GGCTTGGTCTCCCAAAGTGCTGG + Intronic
999970707 5:156859373-156859395 GCCTTGGTGTCCTAAAGTGCTGG - Intergenic
1000187379 5:158872447-158872469 GCCTTGGCATCCTGAAGGGCTGG + Intronic
1002663353 5:180805500-180805522 GCGTTGGTCTCCTAAAGTGCTGG - Intronic
1002898568 6:1392950-1392972 GGGTGGGTATCCTATAGGGACGG - Intronic
1002920336 6:1564910-1564932 AGGTGGGTATCATAAAAGGCTGG + Intergenic
1004123292 6:12847064-12847086 GCGTTGGCCTCCCAAAGGGCTGG + Intronic
1005408203 6:25514670-25514692 ACCTTGGTATCCTAAAGTGCTGG - Intronic
1006084095 6:31583966-31583988 GTGTTGGCCTCCTAAAGTGCTGG + Intergenic
1006084172 6:31584523-31584545 GCCTTGGTCTCCTAAAGTGCTGG - Intergenic
1006099280 6:31676101-31676123 GCGTTGGCCTCCCAAAGGGCTGG - Intergenic
1006649171 6:35536832-35536854 GCGTTGGTGTCCCAAAGTGCTGG - Intergenic
1006773793 6:36576303-36576325 GCCTTGGTCTCCCAAAGGGCTGG - Intergenic
1006839116 6:37016784-37016806 GGCTTGGCCTCCTAAAGTGCTGG + Intronic
1008477949 6:51952816-51952838 GGCATGGTACCCTAAGGGGCTGG - Intronic
1008695687 6:54033512-54033534 GCCTTGGTCTCCTAAAGTGCTGG + Intronic
1009935391 6:70228301-70228323 GGTTTGGTATCTTCAGGGGCTGG - Intronic
1013763960 6:113552761-113552783 GCGTTGGCCTCCTACAGGGCTGG - Intergenic
1015135029 6:129859041-129859063 GGTTTGGCCTCCTAAAGTGCTGG + Intronic
1015785465 6:136918488-136918510 GGCTTGGCCTCCTAAAGTGCTGG + Intergenic
1015996792 6:139003003-139003025 GCCTTGGTCTCCCAAAGGGCTGG + Intergenic
1016180148 6:141135932-141135954 GCCTTGGTCTCCTAAAGTGCTGG - Intergenic
1017141412 6:151193573-151193595 GCGTCGGTCTCCTAAAGTGCTGG - Intergenic
1018586660 6:165368243-165368265 GGCTTGGCATCCCAAAGTGCTGG + Intronic
1019402333 7:862900-862922 GCCTTGGTCTCCTAAAGTGCTGG - Intronic
1020123983 7:5522306-5522328 CTGTTGGTCTCCTAGAGGGCTGG - Intergenic
1021084203 7:16402186-16402208 GGCTTGGGATCTTGAAGGGCAGG + Intronic
1021614349 7:22487182-22487204 GCCTTGGTCTCCTAAAGTGCTGG - Intronic
1021807369 7:24370773-24370795 TGGGTGGACTCCTAAAGGGCAGG + Intergenic
1022077896 7:26991650-26991672 GTGTTGGACTCCTAAAGGGATGG - Intronic
1024643738 7:51354257-51354279 GCCTTGGTCTCCTAAAGTGCTGG + Intergenic
1025070325 7:55892621-55892643 GCCTTGGTCTCCTAAAGTGCTGG - Intronic
1025752036 7:64302236-64302258 GGCTTGGAATCCTAACTGGCAGG + Intergenic
1025915224 7:65860476-65860498 GCCTTGGTCTCCTAAAGTGCTGG - Intergenic
1026161336 7:67871415-67871437 GCGTTGGCCTCCTAAAGTGCTGG + Intergenic
1029162704 7:98563894-98563916 GCCTTGGTCTCCTAAAGTGCTGG + Intergenic
1029269606 7:99369257-99369279 GTCTTGGTCTCCTAAAGTGCTGG - Intronic
1029542165 7:101190228-101190250 GCCTTGGTCTCCCAAAGGGCTGG - Intergenic
1030437628 7:109544810-109544832 GCCTTGGCATCCTAAAGTGCTGG + Intergenic
1032008737 7:128326888-128326910 GCCTTGGTCTCCTAAAGAGCTGG - Intronic
1032518200 7:132522517-132522539 GCCTTGGCATCCTAAAGTGCTGG - Intronic
1032599671 7:133279766-133279788 GCCTTGGTCTCCTAAAGTGCTGG + Intronic
1032938447 7:136761020-136761042 GCCTTGGTATCCCAAAGTGCTGG - Intergenic
1033094147 7:138415072-138415094 GTGTTGGTCTCCCAAAGTGCTGG + Intergenic
1033119777 7:138657389-138657411 ACCTTGGTTTCCTAAAGGGCTGG + Intronic
1033923260 7:146422734-146422756 GCCTTGGAATCCTAAAGTGCTGG + Intronic
1035695580 8:1593203-1593225 GCCTTGGTCTCCTAAAGTGCTGG - Intronic
1035945703 8:3959248-3959270 GCCTTGGCATCCTAAAGTGCTGG - Intronic
1035968825 8:4224858-4224880 GCCTTGGTATCCCAAAGTGCTGG - Intronic
1037421235 8:18705276-18705298 GGCTTGGCCTCCCAAAGGGCTGG - Intronic
1037656573 8:20888809-20888831 GCCTTGGTTTCCTAAAGTGCTGG - Intergenic
1038787051 8:30627577-30627599 GTGTTGGTCTCCCAAAGTGCTGG - Intronic
1039294467 8:36134438-36134460 GCCTTGGTCTCCCAAAGGGCTGG + Intergenic
1039604631 8:38870503-38870525 GCCTTGGCATCCTAAAGTGCTGG - Intergenic
1039795261 8:40907459-40907481 GCGTTGGTCTCCCAAAGTGCTGG - Intergenic
1040425086 8:47277603-47277625 GCCTTGGTCTCCTAAAGTGCTGG + Intronic
1041595975 8:59653552-59653574 GGCTTGGCCTCCTAAAGTGCTGG - Intergenic
1041664732 8:60431982-60432004 GCCTTGGTCTCCTAAAGTGCTGG - Intergenic
1042172070 8:66001158-66001180 GCCTTGGTCTCCTAAAGTGCTGG - Intergenic
1042930736 8:74011609-74011631 GCCTTGGTATCCCAAAGTGCTGG - Intronic
1043439959 8:80268186-80268208 GCCTTGGTTTCCCAAAGGGCTGG + Intergenic
1044034651 8:87285619-87285641 GCCTTGGTCTCCTAAAGTGCTGG - Intronic
1044068725 8:87728589-87728611 GGGCTGGTATGCTAAACAGCTGG + Intergenic
1044216883 8:89622816-89622838 GGGTTGGCATCCTGAAAGGTGGG + Intergenic
1044625948 8:94235092-94235114 GGCTTGGAATCCAGAAGGGCTGG + Intergenic
1044910868 8:97056997-97057019 GGGTTGCTTTCCTAAAGGAGGGG - Intronic
1045474725 8:102543065-102543087 GGCTTGGCCTCCCAAAGGGCTGG + Intergenic
1046801282 8:118430607-118430629 GCCTTGGTCTCCTAAAGTGCTGG + Intronic
1047093297 8:121596880-121596902 GCCTTGGTCTCCTAAAGTGCTGG - Intergenic
1048035793 8:130676145-130676167 AGGTTGGTTTCCTAAAGGGATGG + Intergenic
1048070654 8:131017317-131017339 GCCTTGGTCTCCTAAAGTGCTGG + Intronic
1050670375 9:7989938-7989960 GCCTTGGTCTCCTAAAGTGCTGG + Intergenic
1052166060 9:25329701-25329723 GCCGTGGTCTCCTAAAGGGCTGG + Intergenic
1052856885 9:33412781-33412803 GCCTTGGTTTCCTAAAGTGCTGG - Intergenic
1053089955 9:35266050-35266072 GGCTTGGTCTCCAAAAGTGCTGG + Intronic
1053121271 9:35548778-35548800 GGCTTGGCCTCCCAAAGGGCTGG - Intronic
1053362618 9:37500096-37500118 GCCTTGGTCTCCTAAAGTGCTGG + Intronic
1055294402 9:74819392-74819414 GCCTTGGTCTCCTAAAGTGCTGG - Intronic
1055976798 9:81963267-81963289 GCTTTGGTCTCCTAAAGTGCTGG + Intergenic
1056517865 9:87372011-87372033 GCCTTGGCATCCCAAAGGGCTGG - Intergenic
1056588774 9:87948110-87948132 GTGTTGGCCTCCTAAAGTGCTGG - Intergenic
1056765258 9:89441217-89441239 GGGTTGGTATTCGTAAGGTCTGG - Intronic
1057591652 9:96378182-96378204 GGCTTGGCCTCCTAAAGTGCTGG - Intronic
1057739406 9:97698697-97698719 GTGTTGGCCTCCCAAAGGGCTGG - Intergenic
1060744470 9:126121986-126122008 GTCTTGGTATCCCAAAGTGCTGG + Intergenic
1061612461 9:131756196-131756218 GGGTTGGCCTCCCAAAGTGCTGG + Intergenic
1061717059 9:132525267-132525289 GCGTTGGCCTCCTAAAGTGCTGG + Intronic
1203584667 Un_KI270746v1:53940-53962 GGCTTGGCATCCCAAAGTGCTGG + Intergenic
1186000282 X:5001857-5001879 GCCTTGGCCTCCTAAAGGGCTGG - Intergenic
1187058904 X:15767093-15767115 GGGTTGGTATCCTATAGACTGGG - Intronic
1187340831 X:18420094-18420116 GCCTTGGTCTCCTAAAGTGCTGG + Intergenic
1189288249 X:39867147-39867169 GCCTTGGTCTCCTAAAGTGCTGG - Intergenic
1191061497 X:56302313-56302335 GGTTTGGTATTCTAAAGGGATGG - Intergenic
1192566478 X:72168245-72168267 GCCTTGGCCTCCTAAAGGGCTGG - Intergenic
1193118950 X:77803279-77803301 GCCTTGGTATCCTAAAGTGCTGG + Intergenic
1193148175 X:78098882-78098904 GCTTTGGCCTCCTAAAGGGCTGG + Intronic
1193726719 X:85049532-85049554 GCCTTGGCATCCTAAAGTGCTGG - Intronic
1195030559 X:100923408-100923430 GTGCTGGGATCCTAAAGTGCTGG + Intronic
1195160727 X:102168184-102168206 GGCTTGGCCTCCTAAAGTGCCGG - Intergenic
1195948973 X:110247304-110247326 GGCTTGGCCTCCTAAAGTGCTGG - Intronic
1196002108 X:110796535-110796557 GGTTTGGTGTCCTTAAAGGCGGG + Intergenic
1196732002 X:118950374-118950396 GCCTTGGTCTCCTAAAGTGCTGG + Intergenic
1197215714 X:123864929-123864951 GCGTTGGCCTCCTAAAGTGCTGG + Intronic
1197799408 X:130333950-130333972 GCCTTGGTCTCCTAAAGTGCTGG - Intergenic
1198334632 X:135654545-135654567 GCCTTGGTATCCCAAAGTGCTGG + Intergenic
1198456937 X:136826105-136826127 TGGTTGATATCCTCAAGGGATGG - Intergenic
1199824989 X:151489897-151489919 GCCTTGGCATCCTAAAGTGCTGG - Intergenic
1200404663 Y:2797604-2797626 GCCTTGGTCTCCTAAAGTGCTGG - Intergenic